Metadata-Version: 2.2
Name: arda-mapper
Version: 2.18.0
Summary: Antigen Receptor Domain Annotation — fast TCR/BCR FR/CDR region annotation
Keywords: immunology,tcr,bcr,airr,igblast,mmseqs2,annotation
Author-Email: Mikhail Shugay <mikhail.shugay@gmail.com>
License: GPLv3
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: C++
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Project-URL: Homepage, https://github.com/antigenomics/arda
Project-URL: Repository, https://github.com/antigenomics/arda
Requires-Python: >=3.10
Requires-Dist: polars>=1.0
Requires-Dist: typer>=0.12
Requires-Dist: requests>=2.31
Requires-Dist: seqtree>=0.4
Requires-Dist: dnaio>=1.2
Provides-Extra: docs
Requires-Dist: sphinx; extra == "docs"
Requires-Dist: pydata-sphinx-theme; extra == "docs"
Requires-Dist: nbsphinx; extra == "docs"
Provides-Extra: test
Requires-Dist: pytest; extra == "test"
Requires-Dist: pytest-cov; extra == "test"
Requires-Dist: airr>=1.4; extra == "test"
Provides-Extra: dev
Requires-Dist: ruff; extra == "dev"
Requires-Dist: pytest; extra == "dev"
Requires-Dist: pybind11; extra == "dev"
Provides-Extra: rnaseq
Provides-Extra: mmseqs
Provides-Extra: groundtruth
Requires-Dist: olga; extra == "groundtruth"
Description-Content-Type: text/markdown

<p align="center">
  <picture>
    <source media="(prefers-color-scheme: dark)" srcset="assets/arda_dark.svg">
    <source media="(prefers-color-scheme: light)" srcset="assets/arda_light.svg">
    <!-- Absolute PNG fallback: PyPI strips <picture>/<source> and cannot render a relative or
         raw-served SVG, so the logo must be an absolute-URL raster here. GitHub uses the SVG sources. -->
    <img alt="arda" src="https://raw.githubusercontent.com/antigenomics/arda/master/assets/arda_dark.png" width="340">
  </picture>
</p>

<h1 align="center">arda — Antigen Receptor Domain Annotation</h1>

<p align="center">
  <a href="https://pypi.org/project/arda-mapper/"><img alt="PyPI" src="https://img.shields.io/pypi/v/arda-mapper"></a>
  <a href="https://github.com/antigenomics/arda/actions/workflows/ci.yml"><img alt="CI" src="https://github.com/antigenomics/arda/actions/workflows/ci.yml/badge.svg"></a>
  <a href="https://docs.isalgo.dev/arda/"><img alt="docs" src="https://github.com/antigenomics/arda/actions/workflows/docs.yml/badge.svg"></a>
  <img alt="python" src="https://img.shields.io/badge/python-3.10%2B-blue">
  <img alt="license" src="https://img.shields.io/badge/license-GPLv3-green">
</p>

**Versatile, fast, exact** FR/CDR annotation of **TCR** and **BCR** sequences —
mRNA and protein in FASTA, and reads in FASTQ from both **amplicon** and **bulk
RNA-seq** — for nucleotide *and* amino-acid input, across all loci at once.

`arda` does the expensive IgBLAST work **once, offline** — building a pre-aligned
reference database of every in-frame V·J germline scaffold with FR1–4 / CDR1–3
markup — then at runtime maps your sequences to that database with **MMseqs2** and
transfers the markup through the alignment in a small **C++** hot path. The result
is a **spec-valid [AIRR](https://docs.airr-community.org/) Rearrangement** annotation
that matches IgBLAST (98–99.7% region concordance on real GenBank mRNA), from a plain
CLI + Python library — no Docker, no workflow engine.

It also annotates records that have **no read behind them** — a CDR3 amino acid, a V
call and a J call, as in a VDJdb row — marking up which residues each germline
templates, repairing the junction, and inferring the D gene from the junction's length.

## Why

IgBLAST is the gold standard but is slow to invoke per-batch and awkward to embed.
`arda` keeps IgBLAST-quality region calls while being:

- **Fast & scalable** — MMseqs2 search + a C++ projection step; on a TRA amplicon it
  matches MiXCR's wall clock at **3.6× less CPU and 4.8× less RSS**
  ([below](#performance)); multiprocessing and SLURM-friendly from small FASTA to large FASTQ.
- **Embeddable** — `import arda; arda.annotate_sequences(...)`.
- **Honest** — a D call is gated on an E-value that ships with it (`d_support`), a
  germline allele with no derivable anchor is flagged rather than guessed, a junction
  whose Cys104 anchor is not actually in the read is **not emitted**, and a `j_call`
  requires J evidence rather than being inherited from the scaffold.
- **Easy to install** — `pip install arda-mapper` (binary wheels ship the C++
  extension); the `mmseqs` binary is fetched as a static build at runtime — no
  conda. IgBLAST is fetched on first use the same way, and is only needed to
  (re)build the reference DB or to run `arda igblast`, never for annotation.

## Install

```bash
pip install arda-mapper   # from PyPI (imports as `arda`); binary wheels ship the C++ extension
```

`mmseqs2` (the search backend) is fetched/managed by arda at runtime. For development — and to
get the committed germline references on disk — use `setup.sh`:

```bash
bash setup.sh            # uv .venv, builds the C++ extensions, fetches IgBLAST + static mmseqs
source .venv/bin/activate
```

Needs [uv](https://docs.astral.sh/uv/). Flags: `--build-db` (rebuild references after install),
`--tests` (run the unit + synthetic suites — and **fail** if they fail). It installs
`.[test,dev]`, wipes any stale `build/` first, and then verifies three things that a bare
`import arda` does **not**: that `_markup`, `_segmap` and `_denoise` actually compiled (arda falls
back to a pure-Python markup path otherwise, so a failed build looks like a successful install and
surfaces later as a silent slowdown), that `mmseqs` resolves, and that every mode and stage
command resolves on the CLI. The committed `database/vdj/<organism>/`
references mean **most users never need to build anything**. A `pip install arda-mapper`
with no source checkout **auto-fetches** the curated references into `~/.cache/arda` on
first use and builds the MMseqs2 index there — no `$ARDA_HOME`, no build step
(set `ARDA_NO_AUTO_FETCH` for air-gapped runs with a pre-populated cache).

Supported organisms: **human, mouse** (full IG + TR), **rat, rabbit, rhesus_monkey**
(IG only — IgBLAST ships no TR internal annotation for these).

## CLI

**Three modes, named after the library** — each owns the speed configuration that regime needs:

```bash
arda rnaseq   --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/   # bulk / whole-transcriptome
arda amplicon --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/   # targeted RepSeq / 5'RACE
arda singlecell                                               # reserved — not implemented yet
```

Each runs `map` → `assemble` → `correct` and writes `<prefix>.airr.tsv`, `<prefix>.clones.tsv`,
`<prefix>.assembled.airr.tsv` and `<prefix>.arda.json`. `--exact` turns every speedup off.

The **stages** are separate commands, so any one can be run, inspected or replaced:

```bash
arda map      --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv   # Stage 1: receptor reads out of RNA-seq
arda map      --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv --junction-quality  # + Phred over the junction
arda assemble -i mapped.airr.tsv -o assembled.airr.tsv         # Stage 3: CDR3s no single read spans
arda correct  -i mapped.airr.tsv --extra-airr assembled.airr.tsv -o clones.tsv   # Stage 2: clonotypes
arda correct  -i mapped.airr.tsv -o clones.tsv --ec-mode accurate    # quality-gated correction
arda correct  -i mapped.airr.tsv -o clones.tsv --call-level gene     # collapse allele-level call splits
arda shm      -i mapped.airr.tsv -o rescoped.airr.tsv          # recount SHM outside the junction
```

Everything else:

```bash
arda info                                   # resolved paths + tool availability
arda annotate -i reads.fastq -o out.airr.tsv --organism human --seqtype nt
arda annotate -i prot.fasta  -o out.airr.tsv --organism human --seqtype aa
arda annotate -i reads.fastq -o out.airr.tsv --strand forward   # plus-strand only
arda annotate -i reads.fastq -o out.airr.tsv --d-max-evalue 0.01  # the strict D band
arda markup -i junctions.tsv -o marked.tsv --report -           # mark up + repair bare (CDR3aa, V, J) records
arda resolve-ties -i mapped.airr.tsv -o widened.airr.tsv        # every germline the read cannot rule out
arda cluster submit --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE --shards 20 --partition cpu
arda igblast -i reads.fastq -o truth.airr.tsv                   # gold-standard IgBLAST (all loci)
arda export-ref --kind segments --locus TRB --format fasta      # the reference, out of the CLI
arda build-db   --organism all              # rebuild references (needs IgBLAST)
arda build-index --organism all             # (re)build the precompiled mmseqs DBs
```

`arda cluster` holds every sharded/SLURM helper. `arda cluster submit` shards Stage 1 across an
array and runs Stages 2–3 **once** over the merged output — byte-identical to a single-node run.
`arda cluster split-fasta` / `submit-fasta` are the **amplicon / single-end** FASTA path: they drop
quality and separate mates, so paired RNA-seq must not use them.

**`arda export-ref`** dumps arda's most valuable offline artifact — every in-frame V·J
scaffold with IgBLAST-quality FR1–4 / CDR1–3 coordinates — in 3 kinds × 4 formats:

```bash
arda export-ref --kind scaffolds --locus TRB --format gff3 -o trb.gff3   # V×J (and J+C) reference
arda export-ref --kind segments  --locus TRB --format fasta              # collapsed per-allele V/J/C
arda export-ref --kind anchors   --locus TRB                             # per-allele CDR3 anchors (tsv)
```

Coordinates are **1-based closed** (AIRR), so they pass through GFF3 unchanged; `--format airr`
shapes a scaffold as an AIRR Rearrangement row, feedable straight into anything reading arda's
own output. Details: [reference export](https://docs.isalgo.dev/arda/reference_export.html).

[`examples/`](examples/) is a runnable tour, every artifact derived from real data committed to
this repo and regenerated by `python examples/regenerate.py`: one real mRNA per locus; the two
human reads (of 7,341, across five organisms) that carry a **tandem D-D**; seven VDJdb records
covering every junction-repair outcome; and a 1,035-read FASTQ that runs the whole bulk RNA-seq
pipeline in ~6 s. See [`CHANGELOG.md`](CHANGELOG.md) for what changed per release.

Input may be FASTA or FASTQ, plain or gzipped. Nucleotide input is searched on **both strands**
by default (reverse-complement reads are re-oriented and flagged `rev_comp=T`); a single search
annotates a mixed bulk RNA-seq file across all loci.

## Modes: pick the command, not the flags

The speed configurations are **regime-specific and do not compose**, and picking the wrong one is
slower than picking none. So the regime is the **command name**, and arda owns what it implies:

| command | for | speed configuration | denoising default |
|---|---|---|---|
| `arda rnaseq` | whole-transcriptome bulk RNA-seq (0.02–3 % receptor) | `--prefilter` | `--ec-mode rnaseq` |
| `arda amplicon` | targeted RepSeq / 5′RACE (reads span V into J) | `--two-pass --fast-segments --v-only-on-segment` | `--ec-mode amplicon` |
| `arda singlecell` | *reserved — not implemented* | — | — |

```bash
arda amplicon --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/
arda rnaseq   --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/
arda rnaseq   --r1 R1.fq.gz --r2 R2.fq.gz -p SAMPLE -d out/ --exact   # no speedups at all
```

⛔ Until 2.16.0 the only entry point was `arda rnaseq run`, used for amplicon as well, with the
regime spelled out as four loose flags. **`--two-pass` alone is a LOSS** — 0.762× on bulk, 0.87× on
an IGH amplicon — and it was the one flag that entry point exposed for four releases. Naming the
mode makes the dominated combination unreachable by accident. `arda rnaseq run` no longer exists.

The predictor is not the library's name but whether a read hits **both** a V and a J segment —
`fast_fraction` in the run report. Primer-anchored amplicon reads do; bulk reads land anywhere in a
transcript and mostly do not, which is why the segment path is overhead there and the 16-mer
prefilter (a scan-term optimisation) is the bulk lever instead.

⚠ `arda rnaseq` enables `--prefilter`, which costs **~0.15 % of mapped reads** (122 bulk datasets;
up to 2.46 % on one library), concentrated in J→C and hypermutated IGH. Use `--exact` where that
matters. `--indel-rescue` (amplicon only) reroutes indel-bearing reads to the gapped path; its
value tracks SHM load, so it stays a per-library call and never rides the preset — and arda now
**refuses** it outside the amplicon mode rather than ignoring it. Per-flag measurements:
`arda amplicon --help`, `arda map --help` and the
[usage guide](https://docs.isalgo.dev/arda/usage.html).

### Stages, and the flags that select them

`map` → `assemble` → `correct` are separate commands as well as stages inside a mode:

| stage / flag | what it does |
|---|---|
| `--assemble` *(default on)* | contig assembly for long CDR3s no single 100–150 bp read spans; recovers ~95 % of the abundant long clones a filter-only pass misses |
| `--shm framework` *(default)* | SHM (`v_identity`, `v_mutations`, `j_mutations`) scoped **outside the junction** — IGH/IGK/IGL is where it is real |
| `--shm both` | also emit the pre-2.16.0 junction-inclusive values as `*_full` columns |
| `--isotype` *(default on)* | IGH isotype: `c_call`/`c_class`, voted per fragment then per clonotype, reported as **class** never subclass |
| `--call-level gene` | drop the allele suffix before the clonotype key, collapsing allele-level call splits |
| `--map-d` *(default on)* | D and tandem D-D alignment into the junction |

`arda shm -i in.airr.tsv -o out.airr.tsv` does the SHM recount standalone, needing **no reference
and no re-map** — the germline anchors are already in the file.

### Accuracy regimes: which knob for which question

Separate from the speed flags, and set from **what you are going to do with the answer**. All are
off by default; the shipped output does not move unless you ask.

| question | flags | what it buys |
|---|---|---|
| Repertoire-level D usage | *(default, `E ≤ 0.2`)* | highest D recall |
| A D call you will act on, or a tandem D-D you will report | `--d-max-evalue 0.01` | gene agreement vs IgBLAST **.9765 → .9985** (TRB amplicon), at ~⅓ the call rate |
| Low-frequency variant recovery (spike-in, MRD, monoclonal control) | `map --junction-quality` + `correct --error-rate 1e-5 --ec-mode accurate` | keeps both published MIGEC spike-ins **and** monoclonal purity **.96034 → .99530** |
| SHM / lineage trees | *(default)* | `v_mutations`/`j_mutations` in germline coordinates, `+36 ms` per 100 k reads |
| Monoclonal QC / cell-line purity | `--ec-mode amplicon --clonotype-key junction` | Jurkat **90 → 10** clonotypes, TRB purity **.98963 → .99990**, **reads unchanged at 14,531**, and **98.50 %** of them on the two published clones |
| A targeted library that is deep | `--ec-mode amplicon` | quality-directed rescue at 12 subs / 50× — reaches the class the abundance model structurally cannot |
| Bulk RNA-seq, where singletons are mostly real | `--ec-mode rnaseq` | the same rescue kept narrow (6 subs / 200×) |

`--d-max-evalue` is a **recall/precision dial**, not a bug fix: the shipped 0.2 is deliberately the
loosest band, because dropping two thirds of the D calls is the wrong default for a repertoire
tool. `--ec-mode accurate` is `--min-junction-q 20` — it judges the one base that discriminates a
clonotype from its parent on its **Phred score** rather than on abundance, which is a measurement
the abundance model does not have.

⛔ **Every denoising mode MOVES reads onto a parent and never discards them** — the sum of
`duplicate_count` is invariant across modes, and a clonotype with no qualifying parent keeps its
reads and is reported as an orphan. That is not caution: on a polyclonal hypermutated repertoire a
plain quality *filter* at the same threshold would strand **3.70 %** of all junction-bearing reads
with no parent to inherit them. If the read total moves when you change `--ec-mode`, that is a
defect — please report it.

⚠ The modes are **off by default** (`fast` = arda's historical behaviour), because whether the far
class they collapse is badly-sequenced SHM or error is not settled: on a hypermutated IGH
repertoire `amplicon` removes 178 clonotypes carrying 179 reads, 177 of them singletons, and on the
matched naive library it removes **zero**. Depth: [D segments](https://docs.isalgo.dev/arda/d_segments.html),
[SHM](https://docs.isalgo.dev/arda/shm.html),
[error correction](https://docs.isalgo.dev/arda/error_correction.html).

## Performance

### Head-to-head, same input and same job

**TRA amplicon, 100,000 reads, 8 threads.**

| tool | config | wall (s) | CPU (s) | peak RSS (MB) |
|---|---|---:|---:|---:|
| arda 2.11.1 | `--two-pass --fast-segments --v-only-on-segment` | **5.35** | **12.73** | **631** |
| MiXCR 4.7.0 | `align --preset rna-seq --species hsa` | 5.90 | 45.24 | 3,027 |

arda is **1.10× faster on wall clock at 3.6× less CPU and 4.8× less RSS** — the wall figures are
close, the resource figures are not, which is what matters when many samples share a node.

**Bulk RNA-seq, 100,000 reads.**

| tool | wall (s) | CPU (s) | peak RSS (MB) | what it produced |
|---|---:|---:|---:|---|
| arda 2.11.1 | 2.51 | 5.4 | 234 | AIRR record per read, with junction |
| MiXCR 4.7.0 | 4.54 | 31.8 | 3,022 | AIRR record per read, with junction |
| TRUST4 | **1.91** | **4.36** | **192** | candidate read extraction only |

⚠ TRUST4's stage here is **candidate extraction**, not a per-read AIRR record with a junction —
it is doing less work, so the three rows are not like-for-like.

**IGH RepSeq amplicon, 100,000 pairs, 32 threads.** What the amplicon configuration is worth
against the shipped one-pass default on hypermutated IGH:

| dataset | config | wall (s) | peak RSS (MB) |
|---|---|---:|---:|
| IGH_repertoire | one-pass default | 316.44 | 4,018 |
| IGH_repertoire | `--two-pass --fast-segments --v-only-on-segment` | **76.25** | **1,479** |
| IGH_naive | one-pass default | 305.32 | 3,736 |
| IGH_naive | `--two-pass --fast-segments --v-only-on-segment` | **64.86** | **1,363** |

4.15× and 4.71×, at ~2.7× less memory.

**vs TRUST4 on amplicon, same job, same staged input, same read cap** (round 20, 32 threads on
aldan3; every leg of a tier ran on the same input, so no ratio here is cross-job):

| dataset | reads | arda `amplicon` wall (s) | TRUST4 wall (s) |
|---|---:|---:|---:|
| IGH_repertoire | 100,000 | **201.05** | 615.04 |
| IGH_naive | 100,000 | **136.51** | 359.66 |
| migec_exp1_TCR | 500,000 | **316.25** | 423.96 |
| migec_exp1_IGH | 500,000 | 223.77 | **225.10** |

⚠ Wall clock only. The **full-depth (hours-scale) head-to-head and the IgBLAST-truth accuracy leg
scoring both tools on amplicon are scheduled for the next release** — neither is measured yet, and
neither is projected here.

### Synthetic benchmarks vs IgBLAST

⚠ The two tables below are **synthetic** — generated human IGH sequences, not a real library —
from [`scripts/bench_vs_igblast.py`](scripts/bench_vs_igblast.py) and
[`scripts/bench_prefilter.py`](scripts/bench_prefilter.py). They measure scaling shape, not
head-to-head standing; use the tables above for that. 16 threads.

| sequences | arda wall | arda rate | speedup vs IgBLAST | region concordance |
|----------:|----------:|----------:|-------------------:|-------------------:|
| 10,000    | 5.5 s     | ~1.8k/s   | 4.4×               | 98.9%              |
| 50,000    | 16 s      | ~3.0k/s   | 7.3×               |                    |
| 100,000   | 30 s      | ~3.3k/s   | 7.9×               |                    |

Bulk RNA-seq is faster per read than amplicon, because mmseqs prefilters by k-mer matching —
reads with no receptor k-mer are rejected before alignment. 150 nt reads, 16 threads:

| receptor content | throughput |
|-----------------:|-----------:|
| 100% (amplicon)  | ~5.7k reads/s |
| 10%              | ~19k reads/s |
| 1% (blood RNA-seq) | ~25k reads/s |

### Memory

arda is **CPU-bound**; large FASTQ is streamed in bounded chunks (a background reader prefetches
the next chunk while the current one is annotated), so **mapping is flat at ~300–650 MB at any
read depth**. Peak RSS tracks **repertoire richness**, not reads: Stage 3 holds the clone set, so
on a B-cell-rich tumour (28,444 clonotypes from 105 M reads) `correct` peaked at **2,071.7 MB**,
while a colder sample with *more* reads (139 M) peaked at **549 MB**. **Budget ~4 GB**, and size a
SLURM `--mem` from Stage 3, never Stage 1.

## Accuracy

### Recall on bulk RNA-seq — arda vs TRUST4 vs MiXCR

The three-way comparison, on the **same 16 datasets where every tool ran**, 5,273 real fragments,
Wilson 95 % CIs. Best bold; ties bold together.

| tool | config | recall | precision (lower bound) | false positives | FP / 1M reads | peak RSS |
|---|---|---|---|---:|---:|---:|
| **arda** | shipped defaults | **0.986** [.982–.989] | **0.889** [.881–.897] | **70** | **21.9** | **254 MB** |
| **TRUST4** | defaults | **0.987** [.984–.990] | 0.160 [.156–.164] | 22,185 | 6,932.8 | 306 MB |
| MiXCR | `-OallowNoCDR3PartAlignments=true -OminSumScore=40` | 0.964 [.958–.969] | 0.051 [.050–.052] | 91,229 | 28,509.1 | 1,213 MB |
| MiXCR | `align --preset rna-seq` as shipped | 0.193 [.183–.204] | 0.565 [.542–.588] | 91 | 28.4 | 1,213 MB |
| arda | `--reconstruct` (6 paired datasets) | 0.995 | 0.905 | 14 | 11.7 | 249 MB |

**Recall is a statistical tie between arda and TRUST4** — a 6-fragment gap with overlapping CIs, so
both are marked winners and neither should be quoted as "higher recall" than the other.
**Precision is not a tie**: arda's lower bound (0.881) sits above every competitor's *upper* bound.

⚠ **Benchmark MiXCR at its best config, not its default.** `align --preset rna-seq` as shipped
gives 0.193 recall; the two free options above take it to 0.964. Quoting the default alone is the
mistake this project made and had to retract.

⚠ Precision here is a **lower bound** — the grey band `30 ≤ v_score < 70` is scored under neither
metric. ⛔ And TRUST4's recall and FP are scored on its **candidate extraction**, a different (and
much less filtered) stage than arda's post-`--min-score` output; the two are not like-for-like on
FP, which is why the FP column carries a per-1M normalisation rather than a bare ratio.

What explains the table is the **J→C class — 22 % of real fragments** on bulk:

| tool | V-covered reads (n = 4,117) | J→C agreement (n = 1,156) |
|---|---:|---:|
| arda | 0.9864 | **0.9844** |
| TRUST4 | 0.9944 | 0.9611 |
| MiXCR (recall config) | **0.9990** | 0.8382 |
| MiXCR (default) | 0.1482 | 0.3538 |

On V-covered reads every tool is ≥ 0.986. arda's overall recall rests on the 345 `J + C` scaffolds
in its reference, which took that class from 0.0606 to 0.9844 and overall recall from 0.78 to 0.986.
⚠ Reported as *agreement*, not recall: arda now ships C scaffolds, so the adjudicator is no longer
independent of it there.

### Gene calls on a targeted amplicon

Against an IgBLAST truth on a TRA amplicon, 100,000 reads:

| metric | arda 2.11.1 | MiXCR 4.7.0 |
|---|---:|---:|
| v_gene recall | .9867 | **.9973** |
| v_gene precision | **.9996** | .9978 |
| v_allele resolved | **.9868** | n/a |
| j_gene recall | .9892 | **.9904** |
| j_gene precision | .9953 | **.9995** |
| junction precision, among emitted | .99919 | **.99991** |

arda's V calls are the more **precise** of the two: it declines rather than guessing. MiXCR
suffixes every allele `*00`, i.e. it makes no allele call at all, so `v_allele` has no comparator.

**Score alleles as tie lists, not exact strings.** IgBLAST and arda both return an ambiguous
allele as a comma-joined set; scoring that as a miss is a scoring artifact, not an error. Across
25 datasets the median is `v_allele_exact` **.8328** against `v_allele_resolved` **.9763** —
14 points of the apparent gap is the scoring rule.

**A V/J boundary disagreement *inside* the junction is not an error.** V(D)J recombination is
probabilistic: exonuclease chew-back and N/P-nucleotide addition mean the V-end / N-D-N / J-start
partition is often not identifiable from sequence alone, so overlapping V/J/NDN assignments are
acceptable and the ground truth is unknown. What *is* checkable, and what the table scores: the
junction's **outer bounds** (Cys104 and [FW]118), the **gene/allele calls**, and whether a tool
invents a junction it has no anchor for.

On ~7.3k real GenBank mRNA records spanning **all five organisms and their loci** (committed,
gzipped test fixtures), region concordance with IgBLAST on productive records is **98–99.7%** per
organism, and `junction_aa`/`cdr3_aa` match IgBLAST ~99% while satisfying the AIRR invariants
exactly. (GenBank also contains genomic/partial/non-productive entries that confuse both tools;
those are excluded.)

## Bulk RNA-seq mode

`arda rnaseq` is a recall-first pipeline for extracting the repertoire from bulk RNA-seq, where
1–5% of reads are receptor-derived:

```bash
arda map      --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv --report run.json
arda assemble -i mapped.airr.tsv -o assembled.airr.tsv
arda correct  -i mapped.airr.tsv --extra-airr assembled.airr.tsv -o clones.tsv
```

`--extra-airr` is what folds Stage 3 back in; **without it the assembled reads are silently
discarded.** `arda rnaseq` / `arda amplicon` do all three in one call and wire it for you.

- **`map`** streams paired FASTQ, keeps only reads mapping to a receptor scaffold, and writes
  them as AIRR. The reference includes **`J + C` constant-region scaffolds**, so a read spanning
  the J→C splice — which ends in the constant region and has no V to anchor — still maps and
  carries a **`c_call`** (the CH1 exon) plus a **`c_class`** isotype (`IGHG`/`IGHM`/`IGHA` … —
  the class, never the noise-prone subclass). In paired mode the isotype of a CDR3-bearing read
  is recovered from its constant-region mate. `--reconstruct` merges each overlapping mate pair
  into one fragment, resolving overlap mismatches by the higher-Phred base.
- **`assemble`** reconstructs clonotypes whose CDR3 is too long for any single 100–150 bp read to
  span (V(DD)J ultralong, ~20–40 aa) by greedy overlap-extension anchored on Stage-1's per-read
  `cdr3_start`.
- **`correct`** aggregates reads into clonotypes and collapses sequencing-error CDR3 variants.
  Abundance is the AIRR **`duplicate_count`** — every read that *encompasses* the junction,
  the true expression estimate — with **`consensus_count`** for distinct fragments.

`arda igblast -i reads.fastq -o truth.airr.tsv` runs IgBLAST across all loci as a gold-standard
reference for benchmarking (see the `arda-benchmark` project).

### Error correction: `--error-rate` is a per-library calibration

`correct`'s error model is per-base with a **length-scaled threshold** (a mismatch over a longer
junction is likelier an error) and is SHM-indel-tolerant. Its one knob is `--error-rate`, and the
default (1e-3, ~Phred 30) is **not** universally safe:

On the MIGEC spike-in library (PRJNA239303), at the default `--error-rate 1e-3` arda erases both
published spike-in variants. That is a signal-to-noise limit, not a defect: on the paper's own
metric computed over raw reads, **V1/Err1 = 1.35 and V2/Err2 = 0.28** — the second variant is
*less* abundant than the worst 2-substitution PCR error in the same library, so **no
abundance-based method, at any threshold, can separate them.** That is precisely why UMI
consensus exists; it moves V1/Err1 to 26–76 before any correction runs.

What to do about it:

```bash
arda correct -i mapped.airr.tsv --extra-airr assembled.airr.tsv -o clones.tsv --error-rate 1e-5
```

`1e-5` recovers both spike-in variants exactly. On an independent error cloud, `1e-4` kept both
while still removing 72% of the real PCR errors. `--error-rate` has a physical reading — **~1e-3
for raw reads** (the sequencer's Phred-30 substitution rate) and **~1e-5 for UMI-consensus input**
— so calibrate per library rather than trusting one default.

**And it no longer has to cost precision.** `1e-5` used to buy the variants at 3.5 points of
purity on a monoclonal control (.99540 → .96034), because it also stops collapsing real PCR error.
`correct --min-junction-q` gates on the Phred score of the one base that discriminates a clonotype
from its putative parent — a measurement abundance does not have, and one that separates cleanly
(the published spike-ins read median Q 34–35 there, the error cloud around them **median Q 24**):

```bash
arda map     --r1 R1.fq.gz --r2 R2.fq.gz -o mapped.airr.tsv --junction-quality
arda correct -i mapped.airr.tsv -o clones.tsv --error-rate 1e-5 --ec-mode accurate
```

Both variants kept, monoclonal purity back to **.99530**, spurious junctions 297 → 62, distinct
error clonotypes 1,630 → 124. What it cannot do is rescue a variant below the **template-error
floor**: RT and early-PCR errors happen *before* the UMI is attached, so consensus cannot remove
them and they are high-Q by construction. Full write-up, including why `binom`/`betabinom` are not
`accurate`: [error correction](https://docs.isalgo.dev/arda/error_correction.html).

## Library

```python
import arda

records = arda.annotate_sequences(
    ["GACGTGCAG...", ("clone7", "CAGGTG...")],  # strings or (id, seq) pairs
    seqtype="nt", organism="human",
)
# -> list of AIRR record dicts: v_call, d_call/d2_call, j_call, c_call/c_class,
#    fwr1..fwr4, cdr1..cdr3, *_start/*_end (1-based closed), *_aa, junction(_aa),
#    np1/np2/np3, d_support/d2_support, {v,j,c,d}_cigar, v_mutations/j_mutations,
#    sequence_alignment, germline_alignment, productive, ...
# The TSV is a spec-valid AIRR Rearrangement file (passes airr.schema validation).
```

### Records with no read behind them

A VDJdb row is a CDR3 amino acid, a V call and a J call. There is nothing to align, but the
germlines still template a known run of residues into each end of the junction:

```python
from arda.cdr3fix import markup_cdr3
from arda.annotate.dmap import map_d_junction
from arda.dpost import posterior_d

mk = markup_cdr3("CAIRDDKII", "TRAV12-3*01", "TRAJ30*01", "HomoSapiens")
mk.cdr3_repaired            # 'CAIRDDKIIF'  -- the Phe118 anchor restored
[str(e) for e in mk.errors] # ["J del@8 missing 'F' d=0"]
mk.good                     # True: both sides repaired, both anchors present

junction_nt = "TGTGCTCTTGGGCCCCGGCCTTCCTACAGCGAGGAGTTGGGGGATACCCATCGGGCCGATAAACTCATCTTT"
map_d_junction(junction_nt, "TRDV1*01", "TRDJ1*01", "human").d2_call      # 'TRDD3*01' (tandem D-D)
posterior_d("CASSPLGQAYEQYF", "TRBV5-1*01", "TRBJ2-7*01", "human").d_call  # 'TRBD1'
```

**Coordinates here are *junction* space** — Cys104 through Phe/Trp118, **both anchors
included**. That is what VDJdb's `cdr3` column holds, and it is *not* arda's `cdr3` field,
which excludes both. Conflating them silently corrupts every coordinate.

Repair is conservative: only edits adjacent to a conserved anchor are applied, everything
deeper is *reported* and left alone, and a repair is refused outright unless the result opens
with Cys104 and closes with Phe/Trp118.

### Annotating bare germline segments

There is no coverage filter, so a **V-only** or **J-only** query maps to its scaffold and only
the regions inside the query's coverage are returned — a bare V yields `fwr1..fwr3`, a bare J
yields `fwr4`:

```python
from arda.annotate.mapper import annotate_records

recs = annotate_records(
    [("TRBV9*01", v_germline_nt), ("TRBJ2-7*01", j_germline_nt)],
    organism="human", seqtype="nt", strand="forward", map_d=False,
)
```

(mirpy uses exactly this to bake per-allele FR/CDR subsequences into its gene library; see
`tests/synthetic/test_germline_segments.py`. `arda export-ref` is the CLI equivalent.)

## How it works

1. **Reference build** (`arda.refbuild`, offline): download IMGT/V-QUEST germlines
   → enumerate deduplicated in-frame **V×J** scaffolds (D only affects CDR3
   interior, so it isn't enumerated) plus **`J + C` constant-region scaffolds** (the
   CH1 exon spliced onto each J, so J→C reads have somewhere to land) → annotate with
   `igblastn -outfmt 19` → translate → write `database/vdj/<organism>/{alleles.fasta,
   alleles.aa.fasta, markup.tsv, markup.aa.tsv, combinations.tsv, d_germlines.fasta,
   cdr3_anchors.tsv, d_prior.tsv, build.log}`.
2. **Runtime** (`arda.annotate`): MMseqs2 search query→scaffolds → best hit →
   C++ `transfer_regions` projects scaffold region coordinates onto the query
   (handling indels, truncation, mid-codon alignment starts, reverse strand) → for
   VDJ loci a gapless C++ local alignment of the CDR3 interior against the D
   germlines adds `d_call`/`d2_call` + `np*`; a hit on a `J + C` scaffold adds
   `c_call`/`c_class` → AIRR TSV. Ambiguous D and C calls are comma-joined allele
   lists, as V/J already are. Out-of-frame junctions are reported with an N-bridge
   (`_`) so FR4 still reads.

   The V..J interior is bounded by the **per-allele junction anchors** in
   `cdr3_anchors.tsv`, not by the scaffold projection — a scaffold has a 9 nt N-pad
   where a read has a 20–40 nt N-D-N region, so the projection collapses the very window
   the D lives in. A junction is emitted only when the read actually reaches its Cys104
   anchor. The D call is accepted on a Karlin–Altschul E-value (`d_support`, re-thresholdable
   with `--d-max-evalue`) rather than a per-locus score floor, and is constrained by germline
   geometry **before** the statistics: `/OR` orphons sit outside the locus and cannot rearrange
   at all; TRBD2 lies 3′ of the entire TRBJ1 cluster, so a TRBJ1 rearrangement can never be
   assigned TRBD2; and a tandem D-D must run in genomic 5′→3′ order, since deletional joining
   cannot produce any other. D mapping also runs on `--seqtype aa`, against each D germline's
   three translated frames.
3. **Bare records** (`arda.cdr3fix`, `arda.dpost`): a VDJdb-style row — CDR3 amino acid,
   V, J, species, and no read — is marked up against the same anchors (`arda markup`),
   its errors located and conservatively repaired, and optionally given a D gene inferred
   from the junction *length* (`--d-posterior`).

Fast sequence primitives (`translate`, `detect_coding_frame`, `reverse_complement`,
`back_translate`) live in the C++ extension and are re-exported from
`arda.refbuild.translate` — mirpy-API-compatible, so mirpy can `import arda` and reuse them.

The reference ships with **precompiled MMseqs2 indexes** (`database/vdj/<organism>/mmseqs/`),
used automatically when the local MMseqs2 version matches; otherwise arda transparently
rebuilds a private cache on first run (`arda build-index` regenerates the shipped DBs).
`segments.fasta` — the collapsed per-allele reference the two-pass path uses — is *generated*,
not shipped, and is built on demand when missing.

## Pipeline integration

`arda rnaseq` / `arda amplicon` write `<prefix>.clones.tsv` (AIRR clonotypes), `<prefix>.airr.tsv` (mapped
reads), `<prefix>.assembled.airr.tsv` and `<prefix>.arda.json` (run report). Because it is a
plain CLI over named files, it drops into any workflow engine with no glue code.

A ready-to-use **Nextflow module** lives in [`integrations/nextflow/arda/`](integrations/nextflow/arda/):
copy it to `modules/local/arda/`, feed it the trimmed per-sample FASTQ channel the aligners
already use, and it publishes per-sample clonotype tables to `${params.outdir}/arda/`. It ships a
conda `environment.yml` (works with `-profile conda`) and a `Dockerfile`, and emits a
`versions.yml`. See its [README](integrations/nextflow/arda/README.md) and the
[pipeline-integration guide](https://docs.isalgo.dev/arda/pipeline_integration.html).

The module exposes the regime and the denoising framework as params, so nothing needs
`task.ext.args` surgery:

```groovy
params {
    regime             = 'amplicon'   // or 'bulk' (default); per-sample via meta.regime
    arda_ec_mode       = 'amplicon'   // fast (default) | accurate | amplicon | rnaseq
    arda_clonotype_key = 'junction'   // full (default) | junction
    arda_mmseqs        = '/opt/conda/bin/mmseqs'
}
```

It validates both against their allowed sets and **warns** when `arda_ec_mode` and `regime`
disagree (e.g. the amplicon preset on a bulk library), because those presets are tuned to opposite
clonotype-size distributions and picking the wrong one is a real cost rather than a no-op.

**On a cluster**, `arda slurm` writes a `submit.sh` chaining split → `sbatch --array` →
merge with an `afterok` dependency, and a sharded run is **byte-identical** to a single-node one.
⛔ Shard Stage 1 only: error correction compares a clonotype against its neighbours by abundance,
so running it per shard asks the question against a fraction of the evidence. See the
[cluster guide](https://docs.isalgo.dev/arda/cluster.html).

## Roadmap / TODO

See [`ROADMAP.md`](ROADMAP.md) for the full list. Done: the V·J reference build across
5 organisms, MMseqs2 mapping with C++ markup transfer, all-loci querying, streaming I/O,
**D-segment mapping incl. D-D fusions** (nt *and* aa input, E-value gated, genomic-order
constrained), **constant-region `J + C` scaffolds** (`c_call`/`c_class` isotype), **bulk
RNA-seq mode** with long-CDR3 contig assembly and coverage-based expression, **junction
markup + repair on bare records**, **multi-node (SLURM) sharding**, **the segment-based
fast paths** (`--two-pass`, `--fast-segments`, `--v-only-on-segment`, `--prefilter`,
`--indel-rescue`), **per-segment SHM in germline coordinates** (`v_mutations`/`j_mutations`),
**quality-gated error correction** (`--junction-quality`, `--min-junction-q`, `--ec-mode`)
and **`arda export-ref`**.

Next: full-depth clonotype benchmarking; a segment-native per-read path that removes MMseqs2
from the amplicon hot loop; and an `arda.hmm` semi-Markov model of V→N→D→N→J that would
subsume the E-value gate, the genomic-order constraint and the D posterior into one
forward–backward pass.

## Development

```bash
pip install -e .                                      # rebuilds the C++ ext on import
python -m pytest tests/unit tests/synthetic -q        # fast suite (needs mmseqs)
python -m pytest tests/realworld -q                   # vs IgBLAST, on committed fixtures — offline
env RUN_BENCHMARK=1 python -m pytest tests/benchmark -s   # timing/memory/scaling
```

Optional extras gate optional suites: `.[groundtruth]` (`olga`) for the generative ground-truth
tests that keep `arda.cdr3fix` honest, `.[test]` for `airr` schema validation. Without them those
tests **skip**, so `pip install -e '.[test]'` before reading a green suite as full coverage.

Layout: `src/arda/{refbuild,annotate}`, C++ in `src/_markup/markup.cpp` and
`src/_segmap/segmap.cpp`, references in `database/`, downloads in gitignored `bin/` + `data/`.
