Metadata-Version: 2.1
Name: amphipathic
Version: 1.0.2
Summary: This is a library to evaluate an aminoacid sequence and determine an amphipathic index for each alpha helix or beta sheet.
Home-page: https://github.com/ecolell/amphipathic
Author: Eloy Adonis Colell
Author-email: eloy.colell@gmail.com
License: MIT
Platform: UNKNOWN
Classifier: Intended Audience :: Science/Research
Classifier: Programming Language :: Python
Classifier: Programming Language :: Python :: 3.6
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Topic :: Scientific/Engineering :: Information Analysis
Classifier: Topic :: Scientific/Engineering :: Physics
Description-Content-Type: text/markdown
Requires-Dist: beautifulsoup4 (==4.6.3)
Requires-Dist: biopython
Requires-Dist: cachetools
Requires-Dist: ndg-httpsclient (==0.4.0)
Requires-Dist: pyOpenSSL (~=19.0.0)
Requires-Dist: pyasn1
Requires-Dist: requests[security]

amphipathic
===========

[![License](https://img.shields.io/pypi/l/amphipathic.svg)](https://raw.githubusercontent.com/ecolell/amphipathic/master/LICENSE) [![Downloads](https://img.shields.io/pypi/dm/amphipathic.svg)](https://pypi.python.org/pypi/amphipathic/) [![Build Status](https://travis-ci.org/ecolell/amphipathic.svg?branch=master)](https://travis-ci.org/ecolell/amphipathic) [![Coverage Status](https://coveralls.io/repos/ecolell/amphipathic/badge.png)](https://coveralls.io/r/ecolell/amphipathic) [![Code Health](https://landscape.io/github/ecolell/amphipathic/master/landscape.png)](https://landscape.io/github/ecolell/amphipathic/master) [![PyPI version](https://badge.fury.io/py/amphipathic.svg)](http://badge.fury.io/py/amphipathic)

This library can analyze an aminoacid sequence and gives a list of secondary structures with the respective hydrophobicity mean[1] and amphipathic index[1].

When it is useful to calculate this measurements on a secondary structure?

By looking into this measurements for an alpha helix, you can test some hiphotesis related with:

1. the context of a **globular soluble protein**:
    - **hydrofobic core**, it will be no amphipathic and hydrophobic
    - **interface between core and the superficial region**, it will be amphiphatic
    - **superficial region**, it will be no amphipathic and hydrophilic
2. the interactions of a **trans-membrane protein**:
    - **on lipids interaction**, it will be not amphipathic and hidrophobic
    - **on multiple trans-membrane helix interacion** (homomeric or heteromeric), it will be amphipathic building like an *ionic channel*.


Requirements
------------

If you want to use this library on any GNU/Linux or OSX system you just need to execute:

    $ pip install amphipathic


If you want to collaborate with this library, you should download the [github repository](https://github.com/ecolell/amphipathic) and execute:

    $ make deploy


Testing
-------

To test all the project you should use the command:

    $ pytest tests


Example
-------

This library can analyze an aminoacid sequence and gives a list of secondary structures with the respective hydrophobicity mean and amphipathic index.

```python
import amphipathic
resume = amphipathic.index('NLYIQWLKDGGPSSGRPPPS')
print resume
```

or specifing `scale="prift"` from Cornette et al.[1]

```python
import amphipathic
resume = amphipathic.index('NLYIQWLKDGGPSSGRPPPS', scale="prift")
print resume
```


And the result should be:

```python
[[
    {'end': 2,
     'begin': 0,
     'type': u'c',
     'seq': 'nl',
     'amphipathic': {'index': 7.572935321054872e-05, 'mean': 2.6}},
    {'end': 5,
     'begin': 2,
     'type': u'e',
     'seq': 'yiq',
     'amphipathic': {'index': 1.4312912272216411, 'mean': 1.7299999999999998}},
    {'end': 18,
     'begin': 5,
     'type': u'c',
     'seq': 'wlkdggpssgrpp',
     'amphipathic': {'index': 0.002511560979331271, 'mean': -0.43}},
    {'end': 20,
     'begin': 18,
     'type': u'e',
     'seq': 'ps',
     'amphipathic': {'index': 1.6242872515167746, 'mean': -1.34}}
]]
```

Each secondary structure block has specific information like:

  - `type` could be "c" (from coil), "e" (extended/beta sheet) or "h" (alpha helix).
  - `mean` provides the hydrophobicity mean obtained using the aminoacids of the block through Hydrophobicity scales obtained from Table 4 (STA PRIFT **) Cornette et al.[1].
  - `index` provides an amphipathic index adapted from Cornette et al.[1], first implemented into Pablo Daniel Ghiringhelli's PhD thesis[2]. Cornette et al.[1] suggests an scalar equal or greater than 2, means apmhipathicity. On alpha helix cases this is only valid for segments shorter than 20-25 residues. When an alpha helix go further in longitude, the index is not valid anymore.

It also accept a nucleotide sequence to perform the same analysis:

```python
import amphipathic
resume = amphipathic.index('cgcgtccttggagcaatgcagttcaagaccaagaatcgaattgaacctgt')
print resume
```

And the output:

```python
[[
    {'end': 12,
     'begin': 0,
     'type': u'c',
     'seq': 'rvlgamqfktkn',
     'amphipathic': {'index': 0.007560225956225585, 'mean': 0.7825000000000001}},
    {'end': 15,
     'begin': 12,
     'type': u'e',
     'seq': 'rie',
     'amphipathic': {'index': 1.6297837670649824, 'mean': 1.4599999999999997}},
    {'end': 16,
     'begin': 15,
     'type': u'c',
     'seq': 'p',
     'amphipathic': {'index': 0.0, 'mean': -2.23}}
]]
```

Last, it also accept a polyprotein sequence. When working with aminoacid it detect the '*' character as a stop signal:

```python
import amphipathic
resume = amphipathic.index('NLYIQWLKDG*GPSSGRPPPS') 
print resume
```

Usages
------

This library was used into [mistic2](https://mistic2.leloir.org.ar).


Bibliography
------------

[1] Cornette, J. L., Cease, K. B., Margalit, H., Spouge, J. L., Berzofsky, J. A., & DeLisi, C. (1987). Hydrophobicity scales and computational techniques for detecting amphipathic structures in proteins. Journal of Molecular Biology, 195(3), 659–685. doi:10.1016/0022-2836(87)90189-6.

[2] Ghiringhelli D (2002). Virus Junín: Clonado molecular y análisis estructural y funcional del RNA S y sus productos génicos, Facultad de Ciencias Exactas, Universidad Nacional de La Plata.


Questions?
----------

If you want to develope with us or have questions about this library, please file an issue in this repository so some of the project managers can get back to you. Please check the existing (and closed) issues to make sure your issue hasn't already been addressed.


