Coverage for Bio.Align : 18%
Hot-keys on this page
r m x p toggle line displays
j k next/prev highlighted chunk
0 (zero) top of page
1 (one) first highlighted chunk
|
# Copyright 2008-2011 by Peter Cock. # All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package.
One of the most important things in this module is the MultipleSeqAlignment class, used in the Bio.AlignIO module.
"""
#We only import this and subclass it for some limited backward compatibility.
"""Represents a classical multiple sequence alignment (MSA).
By this we mean a collection of sequences (usually shown as rows) which are all the same length (usually with gap characters for insertions or padding). The data can then be regarded as a matrix of letters, with well defined columns.
You would typically create an MSA by loading an alignment file with the AlignIO module:
>>> from Bio import AlignIO >>> align = AlignIO.read("Clustalw/opuntia.aln", "clustal") >>> print(align) SingleLetterAlphabet() alignment with 7 rows and 156 columns TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191 TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191
In some respects you can treat these objects as lists of SeqRecord objects, each representing a row of the alignment. Iterating over an alignment gives the SeqRecord object for each row:
>>> len(align) 7 >>> for record in align: ... print("%s %i" % (record.id, len(record))) gi|6273285|gb|AF191659.1|AF191 156 gi|6273284|gb|AF191658.1|AF191 156 gi|6273287|gb|AF191661.1|AF191 156 gi|6273286|gb|AF191660.1|AF191 156 gi|6273290|gb|AF191664.1|AF191 156 gi|6273289|gb|AF191663.1|AF191 156 gi|6273291|gb|AF191665.1|AF191 156
You can also access individual rows as SeqRecord objects via their index:
>>> print(align[0].id) gi|6273285|gb|AF191659.1|AF191 >>> print(align[-1].id) gi|6273291|gb|AF191665.1|AF191
And extract columns as strings:
>>> print(align[:, 1]) AAAAAAA
Or, take just the first ten columns as a sub-alignment:
>>> print(align[:, :10]) SingleLetterAlphabet() alignment with 7 rows and 10 columns TATACATTAA gi|6273285|gb|AF191659.1|AF191 TATACATTAA gi|6273284|gb|AF191658.1|AF191 TATACATTAA gi|6273287|gb|AF191661.1|AF191 TATACATAAA gi|6273286|gb|AF191660.1|AF191 TATACATTAA gi|6273290|gb|AF191664.1|AF191 TATACATTAA gi|6273289|gb|AF191663.1|AF191 TATACATTAA gi|6273291|gb|AF191665.1|AF191
Combining this alignment slicing with alignment addition allows you to remove a section of the alignment. For example, taking just the first and last ten columns:
>>> print(align[:, :10] + align[:, -10:]) SingleLetterAlphabet() alignment with 7 rows and 20 columns TATACATTAAGTGTACCAGA gi|6273285|gb|AF191659.1|AF191 TATACATTAAGTGTACCAGA gi|6273284|gb|AF191658.1|AF191 TATACATTAAGTGTACCAGA gi|6273287|gb|AF191661.1|AF191 TATACATAAAGTGTACCAGA gi|6273286|gb|AF191660.1|AF191 TATACATTAAGTGTACCAGA gi|6273290|gb|AF191664.1|AF191 TATACATTAAGTATACCAGA gi|6273289|gb|AF191663.1|AF191 TATACATTAAGTGTACCAGA gi|6273291|gb|AF191665.1|AF191
Note - This object is intended to replace the existing Alignment object defined in module Bio.Align.Generic but is not fully backwards compatible with it.
Note - This object does NOT attempt to model the kind of alignments used in next generation sequencing with multiple sequencing reads which are much shorter than the alignment, and where there is usually a consensus or reference sequence with special status. """
annotations=None): """Initialize a new MultipleSeqAlignment object.
Arguments: - records - A list (or iterator) of SeqRecord objects, whose sequences are all the same length. This may be an be an empty list. - alphabet - The alphabet for the whole alignment, typically a gapped alphabet, which should be a super-set of the individual record alphabets. If omitted, a consensus alphabet is used. - annotations - Information about the whole alignment (dictionary).
You would normally load a MSA from a file using Bio.AlignIO, but you can do this from a list of SeqRecord objects too:
>>> from Bio.Alphabet import generic_dna >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> a = SeqRecord(Seq("AAAACGT", generic_dna), id="Alpha") >>> b = SeqRecord(Seq("AAA-CGT", generic_dna), id="Beta") >>> c = SeqRecord(Seq("AAAAGGT", generic_dna), id="Gamma") >>> align = MultipleSeqAlignment([a, b, c], annotations={"tool": "demo"}) >>> print(align) DNAAlphabet() alignment with 3 rows and 7 columns AAAACGT Alpha AAA-CGT Beta AAAAGGT Gamma >>> align.annotations {'tool': 'demo'}
NOTE - The older Bio.Align.Generic.Alignment class only accepted a single argument, an alphabet. This is still supported via a backwards compatible "hack" so as not to disrupt existing scripts and users, but is deprecated and will be removed in a future release. """ if isinstance(records, Alphabet.Alphabet) \ or isinstance(records, Alphabet.AlphabetEncoder): if alphabet is None: #TODO - Remove this backwards compatible mode! alphabet = records records = [] import warnings from Bio import BiopythonDeprecationWarning warnings.warn("Invalid records argument: While the old " "Bio.Align.Generic.Alignment class only " "accepted a single argument (the alphabet), the " "newer Bio.Align.MultipleSeqAlignment class " "expects a list/iterator of SeqRecord objects " "(which can be an empty list) and an optional " "alphabet argument", BiopythonDeprecationWarning) else : raise ValueError("Invalid records argument") if alphabet is not None : if not (isinstance(alphabet, Alphabet.Alphabet) or isinstance(alphabet, Alphabet.AlphabetEncoder)): raise ValueError("Invalid alphabet argument") self._alphabet = alphabet else : #Default while we add sequences, will take a consensus later self._alphabet = Alphabet.single_letter_alphabet
self._records = [] if records: self.extend(records) if alphabet is None: #No alphabet was given, take a consensus alphabet self._alphabet = Alphabet._consensus_alphabet(rec.seq.alphabet for rec in self._records if rec.seq is not None)
# Annotations about the whole alignment if annotations is None: annotations = {} elif not isinstance(annotations, dict): raise TypeError("annotations argument should be a dict") self.annotations = annotations
"""Add more SeqRecord objects to the alignment as rows.
They must all have the same length as the original alignment, and have alphabets compatible with the alignment's alphabet. For example,
>>> from Bio.Alphabet import generic_dna >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> from Bio.Align import MultipleSeqAlignment >>> a = SeqRecord(Seq("AAAACGT", generic_dna), id="Alpha") >>> b = SeqRecord(Seq("AAA-CGT", generic_dna), id="Beta") >>> c = SeqRecord(Seq("AAAAGGT", generic_dna), id="Gamma") >>> d = SeqRecord(Seq("AAAACGT", generic_dna), id="Delta") >>> e = SeqRecord(Seq("AAA-GGT", generic_dna), id="Epsilon")
First we create a small alignment (three rows):
>>> align = MultipleSeqAlignment([a, b, c]) >>> print(align) DNAAlphabet() alignment with 3 rows and 7 columns AAAACGT Alpha AAA-CGT Beta AAAAGGT Gamma
Now we can extend this alignment with another two rows:
>>> align.extend([d, e]) >>> print(align) DNAAlphabet() alignment with 5 rows and 7 columns AAAACGT Alpha AAA-CGT Beta AAAAGGT Gamma AAAACGT Delta AAA-GGT Epsilon
Because the alignment object allows iteration over the rows as SeqRecords, you can use the extend method with a second alignment (provided its sequences have the same length as the original alignment). """ if len(self): #Use the standard method to get the length expected_length = self.get_alignment_length() else: #Take the first record's length records = iter(records) # records arg could be list or iterator try: rec = next(records) except StopIteration: #Special case, no records return expected_length = len(rec) self._append(rec, expected_length) #Now continue to the rest of the records as usual
for rec in records: self._append(rec, expected_length)
"""Add one more SeqRecord object to the alignment as a new row.
This must have the same length as the original alignment (unless this is the first record), and have an alphabet compatible with the alignment's alphabet.
>>> from Bio import AlignIO >>> align = AlignIO.read("Clustalw/opuntia.aln", "clustal") >>> print(align) SingleLetterAlphabet() alignment with 7 rows and 156 columns TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191 TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191 >>> len(align) 7
We'll now construct a dummy record to append as an example:
>>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> dummy = SeqRecord(Seq("N"*156), id="dummy")
Now append this to the alignment,
>>> align.append(dummy) >>> print(align) SingleLetterAlphabet() alignment with 8 rows and 156 columns TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273285|gb|AF191659.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273284|gb|AF191658.1|AF191 TATACATTAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273287|gb|AF191661.1|AF191 TATACATAAAAGAAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273286|gb|AF191660.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273290|gb|AF191664.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273289|gb|AF191663.1|AF191 TATACATTAAAGGAGGGGGATGCGGATAAATGGAAAGGCGAAAG...AGA gi|6273291|gb|AF191665.1|AF191 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...NNN dummy >>> len(align) 8
""" if self._records: self._append(record, self.get_alignment_length()) else: self._append(record)
"""Helper function (PRIVATE).""" if not isinstance(record, SeqRecord): raise TypeError("New sequence is not a SeqRecord object")
#Currently the get_alignment_length() call is expensive, so we need #to avoid calling it repeatedly for __init__ and extend, hence this #private _append method if expected_length is not None and len(record) != expected_length: #TODO - Use the following more helpful error, but update unit tests #raise ValueError("New sequence is not of length %i" \ # % self.get_alignment_length()) raise ValueError("Sequences must all be the same length")
#Using not self.alphabet.contains(record.seq.alphabet) needs fixing #for AlphabetEncoders (e.g. gapped versus ungapped). if not Alphabet._check_type_compatible([self._alphabet, record.seq.alphabet]): raise ValueError("New sequence's alphabet is incompatible") self._records.append(record)
"""Combines to alignments with the same number of rows by adding them.
If you have two multiple sequence alignments (MSAs), there are two ways to think about adding them - by row or by column. Using the extend method adds by row. Using the addition operator adds by column. For example,
>>> from Bio.Alphabet import generic_dna >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> from Bio.Align import MultipleSeqAlignment >>> a1 = SeqRecord(Seq("AAAAC", generic_dna), id="Alpha") >>> b1 = SeqRecord(Seq("AAA-C", generic_dna), id="Beta") >>> c1 = SeqRecord(Seq("AAAAG", generic_dna), id="Gamma") >>> a2 = SeqRecord(Seq("GT", generic_dna), id="Alpha") >>> b2 = SeqRecord(Seq("GT", generic_dna), id="Beta") >>> c2 = SeqRecord(Seq("GT", generic_dna), id="Gamma") >>> left = MultipleSeqAlignment([a1, b1, c1], ... annotations={"tool": "demo", "name": "start"}) >>> right = MultipleSeqAlignment([a2, b2, c2], ... annotations={"tool": "demo", "name": "end"})
Now, let's look at these two alignments:
>>> print(left) DNAAlphabet() alignment with 3 rows and 5 columns AAAAC Alpha AAA-C Beta AAAAG Gamma >>> print(right) DNAAlphabet() alignment with 3 rows and 2 columns GT Alpha GT Beta GT Gamma
And add them:
>>> combined = left + right >>> print(combined) DNAAlphabet() alignment with 3 rows and 7 columns AAAACGT Alpha AAA-CGT Beta AAAAGGT Gamma
For this to work, both alignments must have the same number of records (here they both have 3 rows):
>>> len(left) 3 >>> len(right) 3 >>> len(combined) 3
The individual rows are SeqRecord objects, and these can be added together. Refer to the SeqRecord documentation for details of how the annotation is handled. This example is a special case in that both original alignments shared the same names, meaning when the rows are added they also get the same name.
Any common annotations are preserved, but differing annotation is lost. This is the same behaviour used in the SeqRecord annotations and is designed to prevent accidental propagation of inappropriate values:
>>> combined.annotations {'tool': 'demo'}
""" if not isinstance(other, MultipleSeqAlignment): raise NotImplementedError if len(self) != len(other): raise ValueError("When adding two alignments they must have the same length" " (i.e. same number or rows)") alpha = Alphabet._consensus_alphabet([self._alphabet, other._alphabet]) merged = (left+right for left, right in zip(self, other)) # Take any common annotation: annotations = dict() for k, v in self.annotations.items(): if k in other.annotations and other.annotations[k] == v: annotations[k] = v return MultipleSeqAlignment(merged, alpha, annotations)
"""Access part of the alignment.
Depending on the indices, you can get a SeqRecord object (representing a single row), a Seq object (for a single columns), a string (for a single characters) or another alignment (representing some part or all of the alignment).
align[r,c] gives a single character as a string align[r] gives a row as a SeqRecord align[r,:] gives a row as a SeqRecord align[:,c] gives a column as a Seq (using the alignment's alphabet)
align[:] and align[:,:] give a copy of the alignment
Anything else gives a sub alignment, e.g. align[0:2] or align[0:2,:] uses only row 0 and 1 align[:,1:3] uses only columns 1 and 2 align[0:2,1:3] uses only rows 0 & 1 and only cols 1 & 2
We'll use the following example alignment here for illustration:
>>> from Bio.Alphabet import generic_dna >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> from Bio.Align import MultipleSeqAlignment >>> a = SeqRecord(Seq("AAAACGT", generic_dna), id="Alpha") >>> b = SeqRecord(Seq("AAA-CGT", generic_dna), id="Beta") >>> c = SeqRecord(Seq("AAAAGGT", generic_dna), id="Gamma") >>> d = SeqRecord(Seq("AAAACGT", generic_dna), id="Delta") >>> e = SeqRecord(Seq("AAA-GGT", generic_dna), id="Epsilon") >>> align = MultipleSeqAlignment([a, b, c, d, e], generic_dna)
You can access a row of the alignment as a SeqRecord using an integer index (think of the alignment as a list of SeqRecord objects here):
>>> first_record = align[0] >>> print("%s %s" % (first_record.id, first_record.seq)) Alpha AAAACGT >>> last_record = align[-1] >>> print("%s %s" % (last_record.id, last_record.seq)) Epsilon AAA-GGT
You can also access use python's slice notation to create a sub-alignment containing only some of the SeqRecord objects:
>>> sub_alignment = align[2:5] >>> print(sub_alignment) DNAAlphabet() alignment with 3 rows and 7 columns AAAAGGT Gamma AAAACGT Delta AAA-GGT Epsilon
This includes support for a step, i.e. align[start:end:step], which can be used to select every second sequence:
>>> sub_alignment = align[::2] >>> print(sub_alignment) DNAAlphabet() alignment with 3 rows and 7 columns AAAACGT Alpha AAAAGGT Gamma AAA-GGT Epsilon
Or to get a copy of the alignment with the rows in reverse order:
>>> rev_alignment = align[::-1] >>> print(rev_alignment) DNAAlphabet() alignment with 5 rows and 7 columns AAA-GGT Epsilon AAAACGT Delta AAAAGGT Gamma AAA-CGT Beta AAAACGT Alpha
You can also use two indices to specify both rows and columns. Using simple integers gives you the entry as a single character string. e.g.
>>> align[3, 4] 'C'
This is equivalent to:
>>> align[3][4] 'C'
or:
>>> align[3].seq[4] 'C'
To get a single column (as a string) use this syntax:
>>> align[:, 4] 'CCGCG'
Or, to get part of a column,
>>> align[1:3, 4] 'CG'
However, in general you get a sub-alignment,
>>> print(align[1:5, 3:6]) DNAAlphabet() alignment with 4 rows and 3 columns -CG Beta AGG Gamma ACG Delta -GG Epsilon
This should all seem familiar to anyone who has used the NumPy array or matrix objects. """ if isinstance(index, int): #e.g. result = align[x] #Return a SeqRecord return self._records[index] elif isinstance(index, slice): #e.g. sub_align = align[i:j:k] return MultipleSeqAlignment(self._records[index], self._alphabet) elif len(index)!=2: raise TypeError("Invalid index type.")
#Handle double indexing row_index, col_index = index if isinstance(row_index, int): #e.g. row_or_part_row = align[6, 1:4], gives a SeqRecord return self._records[row_index][col_index] elif isinstance(col_index, int): #e.g. col_or_part_col = align[1:5, 6], gives a string return "".join(rec[col_index] for rec in self._records[row_index]) else: #e.g. sub_align = align[1:4, 5:7], gives another alignment return MultipleSeqAlignment((rec[col_index] for rec in self._records[row_index]), self._alphabet)
"""Sort the rows (SeqRecord objects) of the alignment in place.
This sorts the rows alphabetically using the SeqRecord object id by default. The sorting can be controlled by supplying a key function which must map each SeqRecord to a sort value.
This is useful if you want to add two alignments which use the same record identifiers, but in a different order. For example,
>>> from Bio.Alphabet import generic_dna >>> from Bio.Seq import Seq >>> from Bio.SeqRecord import SeqRecord >>> from Bio.Align import MultipleSeqAlignment >>> align1 = MultipleSeqAlignment([ ... SeqRecord(Seq("ACGT", generic_dna), id="Human"), ... SeqRecord(Seq("ACGG", generic_dna), id="Mouse"), ... SeqRecord(Seq("ACGC", generic_dna), id="Chicken"), ... ]) >>> align2 = MultipleSeqAlignment([ ... SeqRecord(Seq("CGGT", generic_dna), id="Mouse"), ... SeqRecord(Seq("CGTT", generic_dna), id="Human"), ... SeqRecord(Seq("CGCT", generic_dna), id="Chicken"), ... ])
If you simple try and add these without sorting, you get this:
>>> print(align1 + align2) DNAAlphabet() alignment with 3 rows and 8 columns ACGTCGGT <unknown id> ACGGCGTT <unknown id> ACGCCGCT Chicken
Consult the SeqRecord documentation which explains why you get a default value when annotation like the identifier doesn't match up. However, if we sort the alignments first, then add them we get the desired result:
>>> align1.sort() >>> align2.sort() >>> print(align1 + align2) DNAAlphabet() alignment with 3 rows and 8 columns ACGCCGCT Chicken ACGTCGTT Human ACGGCGGT Mouse
As an example using a different sort order, you could sort on the GC content of each sequence.
>>> from Bio.SeqUtils import GC >>> print(align1) DNAAlphabet() alignment with 3 rows and 4 columns ACGC Chicken ACGT Human ACGG Mouse >>> align1.sort(key = lambda record: GC(record.seq)) >>> print(align1) DNAAlphabet() alignment with 3 rows and 4 columns ACGT Human ACGC Chicken ACGG Mouse
There is also a reverse argument, so if you wanted to sort by ID but backwards:
>>> align1.sort(reverse=True) >>> print(align1) DNAAlphabet() alignment with 3 rows and 4 columns ACGG Mouse ACGT Human ACGC Chicken
""" if key is None: self._records.sort(key = lambda r: r.id, reverse = reverse) else: self._records.sort(key = key, reverse = reverse)
"""Returns a string containing a given column (DEPRECATED).
This is a method provided for backwards compatibility with the old Bio.Align.Generic.Alignment object. Please use the slice notation instead, since get_column is likely to be removed in a future release of Biopython.. """ import warnings import Bio warnings.warn("This method is deprecated and is provided for backwards compatibility with the old Bio.Align.Generic.Alignment object. Please use the slice notation instead, as get_column is likely to be removed in a future release of Biopython.", Bio.BiopythonDeprecationWarning) return _Alignment.get_column(self, col)
weight = 1.0): """Add a sequence to the alignment (DEPRECATED).
The start, end, and weight arguments are not supported! This method only provides limited backwards compatibility with the old Bio.Align.Generic.Alignment object. Please use the append method with a SeqRecord instead, since add_sequence is likely to be removed in a future release of Biopython. """ import warnings import Bio warnings.warn("The start, end, and weight arguments are not supported! This method only provides limited backwards compatibility with the old Bio.Align.Generic.Alignment object. Please use the append method with a SeqRecord instead, as the add_sequence method is likely to be removed in a future release of Biopython.", Bio.BiopythonDeprecationWarning) #Should we handle start/end/strand information somehow? What for? #TODO - Should we handle weights somehow? See also AlignInfo code... if start is not None or end is not None or weight != 1.0: raise ValueError("The add_Sequence method is obsolete, and only " "provides limited backwards compatibily. The" "start, end and weight arguments are not " "supported.") self.append(SeqRecord(Seq(sequence, self._alphabet), id = descriptor, description = descriptor))
from Bio._utils import run_doctest run_doctest()
|