Metadata-Version: 2.1
Name: dna-analyser-ibp
Version: 2.1.3
Summary: DNA analyser API wrapper tool for Jupiter notebooks.
Home-page: https://gitlab.com/PatrikKaura/DNA_analyser_IBP/
Author: Patrik Kaura
Author-email: patrikkaura@gmail.com
License: GPLv3
Description: <div align="center">
            <img src="https://gitlab.com/PatrikKaura/DNA_analyser_IBP/raw/master/docs/logo.png" alt='logo' width='300px'>
            <br/>
            <br/>
            <img src="https://img.shields.io/badge/version-2.1.3-brightgreen.svg" alt='version'/>
            <img src="https://img.shields.io/badge/python-3.6-brightgreen.svg" alt='python_version'/>
            <img src="https://img.shields.io/badge/python-3.7-brightgreen.svg" alt='python_version'/>
            <img src='https://img.shields.io/badge/licence-GNU%20v3.0-blue.svg' alt='licence'/>
            <h1 align='center'> DNA analyser IBP </h1>
        </div>
        
        
        Tool for creating Palindrome, P53predictor, and G4Hunter analysis. Work as API wrapper for IBP DNA analyzer API [bioinformatics.ibp](http://bioinformatics.ibp.cz/).
        Currently working with an instance of DNA analyser server running on http://bioinformatics.ibp.cz computational core but can be switched 
        to the local instance of the server.
        
        # Getting Started
        
        ## Prerequisites
        
        python >= 3.6
        
        ## Dependencies
        
        * tenacity >= 6.1.0
        * requests >= 2.20
        * requests-toolbelt >= 0.9.1
        * pyjwt >= 1.7.1
        * pandas >= 0.23
        * matplotlib >= 3.0.3
        * tqdm >= 4.28
        
        ## Installing
        
        To install test version from [Pypi](https://pypi.org/project/dna-analyser-ibp/).
        
        ```commandline
        pipenv install dna-analyser-ibp
        ```
        
        ```commandline
        pip install dna-analyser-ibp
        ```
        
        ## Quick start
        
        DNA analyser uses `pandas.Dataframe` or `pandas.Series`. Firstly the user  has to create `Api` object and login to API.
        ```python
        from DNA_analyser_IBP.api import Api
        
        API = Api(server='http://bioinformatics.ibp.cz:8888/api')
        ```
        ```python
        Enter your email        example@example.cz
        Enter your password     ········
        User user@mendelu.cz logged in: 2019-03-27 19:46:56.661376
        ```
        If DNA analyser API server not running on http://bioinformatics.ibp.cz then use this example to create `Api` object.
        ```python
        from DNA_analyser_IBP.api import Api
        
        API = Api(server='http://hostname:port/api')
        ```
        Then upload NCBI sequence for example `Homo sapiens chromosome 12` use.
        ```python
        API.sequence.ncbi_creator(circular= True, tags=['Homo','sapiens', 'chromosome'], name='Homo sapiens chromosome 12', ncbi_id='NC_000012.12')
        ```
        To analyse NCBI sequence use g4hunter interface.
        ```python
        sapiens_sequence = API.sequence.load_all(tags='Homo') # get series with sapiens sequence
        
        # run g4hunter analyses with these params
        API.g4hunter.analyse_creator(sequence=sapiens_sequence, tags=['testovaci','Homo', 'sapiens'], threshold=1.4, window_size=30)
        ```
        Last step to see results of g4hunter analysis.
        ```python
        sapiens = API.g4hunter.load_all(tags=['Homo']) # returns dataframe
        API.g4hunter.load_results(analyse=sapiens.iloc[0]) # iloc[0] to select row from dataframe
        ```
        ## P53 / G4KILLER TOOL
        To run simple tools using plain text input.
        ```python
        # implements g4killer algorithm for generating sequence with lower gscore
        API.g4killer.run(sequence='AATTATTTGGAAAGGGGGGGTTTTCCGA', threshold=0.5) 
        
        # implements calculations of p53 binding predictor for 20 base pairs sequences 
        API.p53.run(sequence='GGACATGCCCGGGCATGTCC') 
        ```
        
        ## Tests
        
        To run tests only when downloaded directly from this repository.
        
        ```commandline
        pytest -v tests/
        ```
        
        ## Authors
        
        * **Patrik Kaura** - *Main developer* - [patrikkaura](https://gitlab.com/PatrikKaura/)
        * **Jan Kolomaznik** - *Supervisor* - [jankolomaznik](https://github.com/Kolomaznik)
        * **Jiří Šťastný** - *Supervisor*
        
        ## License
        
        This project is licensed under the GPL-3.0 License - see the [LICENSE.md](LICENSE.md) file for details.
        
Keywords: dna,ibp,quadruplex,g4hunter,g4killer,palindrome,p53,analysis
Platform: UNKNOWN
Classifier: Intended Audience :: Education
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: GNU General Public License v3 (GPLv3)
Classifier: Operating System :: OS Independent
Classifier: Programming Language :: Python
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.6
Classifier: Programming Language :: Python :: 3.7
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Description-Content-Type: text/markdown
