Metadata-Version: 2.1
Name: HIFI-SE
Version: 1.0.1
Summary: HIFI-SE
Home-page: https://github.com/comery/HIFI-barcode-SE400
Author: Chentao Yang, Guanliang Meng
Author-email: yangchentao@genomics.cn
License: UNKNOWN
Description: # HIFI-barcode-SE400
        The BGISEQ-500 platform has launched a new test sequencing kits capable of single-end 400 bp sequencing (SE400), which offers a simple and reliable way to achieve DNA barcodes efficiently. In this study, we explored the potential of the BGISEQ-500 SE400 sequencing in DNA barcode reference construction, meanwhile provided an updated HIFI-Barcode software package that can generate COI barcode assemblies using HTS reads of length >= 400 bp.
        
        ### manual
        [manual book](https://github.com/comery/HIFI-barcode-SE400/raw/master/HIFI-SE_manual.pdf)
        
        ### Versions
        
        - v1.0.1
        	HIFI-SE v1.0.1 2018/12/2. Changers form previous version:
        	- Add “polish” function 
        	- Fixed several small bugs.
        
        - v1.0.0  
        	HIFI-SE v1.0.0 2018/11/22. Changers form previous version:
        	- Formatted python code writing style as PEP8.
        	- Fixed several small bugs.
        - V0.0.3  
        	HIFI-SE v0.03 2018/11/15. Changes from previous version:
        	- Modify the description of some arguments for better understanding.
        - V0.0.1  
        	HIFI-SE v0.0.1 2018/11/03 beat version, establish the framework and archive almost complete functions.
        
        
        ### Installation
        
        #### System requirement and dependencies 
        Operating system: HIFI-SE is designed to run on most platforms, including UNIX, Linux and MacOS/X. Microsoft Windows. We have tested on Linux and on MacOS/X, because these are the machines we develop on. HIFI-SE is written in python language, and a version 3.5 or higher is required.
        #### Dependencies: 
        - biopython version 1.5 or higher (required). Please check https://biopython.org/ and https://pypi.org/project/biopython/#description for more details on installation of biopython.
        - Another python package - bold_identification is also required for getting complete function of HIFI-SE. See https://pypi.org/project/bold-identification/
        - HIFI-SE supposed you have installed the VSEARCH on your device, and its path in your $PATH. See https://github.com/torognes/vsearch
        
        #### Install
        
        Installation by pip is recommended because it will solve package dependencies automatically, including biopython and bold_identification packages.
        	
        ```shell
        pip install HIFI-SE
        ```
        
        ### Usage (latest==1.0.0)
        
        
        ```shell
        HIFI-SE
        ```
        
        ```text
        usage: HIFI-SE [-h] [-v]
                       {all,filter,assign,assembly,polish,bold_identification} ...
        
        Description
        
            An automatic pipeline for HIFI-SE400 project, including filtering
            raw reads, assigning reads to samples, assembly HIFI barcodes
            (COI sequences).
        
        Version
        
            1.0.1 2018-12-2  Add "polish" function
            1.0.0 2018-11-22 formated as PEP8 style
            0.0.1 2018-11-3
        
        Author
            yangchentao at genomics.cn, BGI.
            mengguanliang at genomics.cn, BGI.
        
        positional arguments:
          {all,filter,assign,assembly,polish,bold_identification}
            all                 run filter, assign and assembly
            filter              filter raw reads
            assign              assign reads to samples
            assembly            do assembly from input fastq
                                reads, output HIFI barcodes.
            polish              polish COI barcode assemblies,
                                output confident barcodes.
            bold_identification
                                do taxa identification
                                on BOLD system,
        
        optional arguments:
          -h, --help            show this help message and exit
          -v, --version         show program's version number and exit
        ```
        
        #### run by steps [filter -> assign -> assembly]
        
        - ```python3 HIFI-SE.py filter ```
        
        ```text
        usage: HIFI-SE filter [-h] -outpre <STR> -raw <STR> [-e <INT>]
                              [-q <INT> <INT>] [-n <INT>]
        
        optional arguments:
          -h, --help      show this help message and exit
        
        common arguments:
          -outpre <STR>   prefix for output files
        
        filter arguments:
          -raw <STR>      input raw Single-End fastq file, and
                          only adapters should be removed;
                          supposed on
                          Phred33 score system (BGISEQ-500)
          -e <INT>        expected error threshod, default=10
                          see more: http://drive5.com/usearch/manual/exp_errs.html
          -q <INT> <INT>  filter by base quality; for example: '20 5' means
                          dropping read which contains more than 5 percent of
                          quality score < 20 bases.
          -n <INT>        remove reads containing [INT] Ns, default=1
        ```
        
        - ```python3 HIFI-SE.py assign```
        
        ```text
        usage: HIFI-SE assign [-h] -outpre <STR> -index INT -fq <STR> -primer <STR>
                              [-outdir <STR>]
        
        optional arguments:
          -h, --help     show this help message and exit
        
        common arguments:
          -outpre <STR>  prefix for output files
        
        index arguments:
          -index INT     the length of tag sequence in the ends of primers
        
        when only run assign arguments:
          -fq <STR>      cleaned fastq file
        
        assign arguments:
          -primer <STR>  taged-primer list, on following format:
                         Rev001   AAGCTAAACTTCAGGGTGACCAAAAAATCA
                         For001   AAGCGGTCAACAAATCATAAAGATATTGG
                         ...
                         this format is necessary!
          -outdir <STR>  output directory for assignment,default="assigned"
        ```
        - ```python3 HIFI-SE.py assembly```
        
        ```
        usage: HIFI-SE assembly [-h] -outpre <STR> -index INT -list FILE
                                [-vsearch <STR>] [-threads <INT>] [-cid FLOAT]
                                [-min INT] [-max INT] [-oid FLOAT] [-tp INT] [-ab INT]
                                [-seqs_lim INT] [-len INT] [-mode INT] [-rc]
                                [-codon INT] [-frame INT]
        
        optional arguments:
          -h, --help      show this help message and exit
        
        common arguments:
          -outpre <STR>   prefix for output files
        
        index arguments:
          -index INT      the length of tag sequence in the ends of primers
        
        only run assembly arguments(not all):
          -list FILE      input file, fastq file list. [required]
        
        software path:
          -vsearch <STR>  vsearch path(only needed if vsearch is not in $PATH)
          -threads <INT>  threads for vsearch, default=2
          -cid FLOAT      identity for clustering, default=0.98
        
        assembly arguments:
          -min INT        minimun length of overlap, default=80
          -max INT        maximum length of overlap, default=90
          -oid FLOAT      minimun similarity of overlap region, default=0.95
          -tp INT         how many clusters will be used inassembly, recommendation=2
          -ab INT         keep clusters to assembly if its abundance >=INT
          -seqs_lim INT   reads number limitation. by default,
                          no limitation for input reads
          -len INT        standard read length, default=400
          -mode INT       1 or 2; modle 1 is to cluster and keep
                          most [-tp] abundance clusters, or clusters
                          abundance more than [-ab], and then make a
                          consensus sequence for each cluster.
                          modle 2 is directly to make only one consensus
                          sequence without clustering. default=1
          -rc             whether to check amino acid translation
                          for reads, default not
        
        translation arguments(when set -rc or -cc):
          -codon INT      codon usage table used to checktranslation, default=5
          -frame INT      start codon shift for amino acidtranslation, default=1
        ```
        -```python3 HIFI-SE.py polish```
        
        ```text
        usage: HIFI-SE polish [-h] -i STR [-cc] [-cov INT] [-l INT] -index INT
                              [-codon INT] [-frame INT]
        
        optional arguments:
          -h, --help  show this help message and exit
        
        polish arguments:
          -i STR      COI barcode assemblies
          -cc         whether to check final COI contig's
                      amino acid translation, default yes
          -cov INT    minimun coverage of 5' or 3' end allowed, default=5
          -l INT      minimun length of COI barcode allowed, default=650
        
        index arguments:
          -index INT  the length of tag sequence in the ends of primers
        
        translation arguments(when set -rc or -cc):
          -codon INT  codon usage table used to checktranslation, default=5
          -frame INT  start codon shift for amino acidtranslation, default=1
        ```
        
        ### Quickstart
        #### Files used in tutorial
        All related files could be found in [github page](https://github.com/comery/HIFI-barcode-SE400/). The important files for tutorial are:
        
        - <i>raw.fastq.gz</i>, raw output fastq file generated from BGISEQ-500 SE400 module.
        - <i>indexed_primer.list</i>, tagged primer list
        
        
        #### Run in "all"
        Example:
        
        ```shell
        python3 HIFI-SE.py all -outpre hifi -raw test.raw.fastq -index 4 -primer index_primer.list -mode 1 -cid 0.98 -oid 0.95 -seqs_lim 50000 -threads 4 -tp 2
        ```
        
        ### Citation
        This work is not be published, but coming soon! I will update this part after publication.
        
        
        
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Science/Research
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: License :: OSI Approved :: GNU General Public License v3 or later (GPLv3+)
Classifier: Programming Language :: Python :: 3
Classifier: Operating System :: MacOS :: MacOS X
Classifier: Operating System :: Microsoft :: Windows
Classifier: Operating System :: POSIX :: Linux
Requires-Python: >=3.5
Description-Content-Type: text/markdown
