Metadata-Version: 1.1
Name: bamnostic
Version: 0.9.1
Summary: Pure Python, OS-agnostic Binary Alignment Map (BAM) random access and parsing tool
Home-page: https://github.com/betteridiot/bamnostic/
Author: Marcus D. Sherman
Author-email: mdsherm@umich.edu
License: BSD 3-Clause
Description: |Build Status| |noarch| |Documentation Status| |Conda Version| |PyPI
        version| |Maintainability|
        
        |status| |DOI| |License|
        
        +---------+---------------------+
        | Host    | Downloads           |
        +=========+=====================+
        | PyPI    | |Downloads|         |
        +---------+---------------------+
        | conda   | |Conda Downloads|   |
        +---------+---------------------+
        
        BAMnostic
        =========
        
        a *pure Python*, **OS-agnositic** Binary Alignment Map (BAM) file parser
        and random access tool.
        
        Note:
        ~~~~~
        
        Documentation can be found at
        `here <http://bamnostic.readthedocs.io/en/latest/>`__ or by going to
        this address: http://bamnostic.readthedocs.io. Documentation was made
        available through `Read the Docs <https://readthedocs.org/>`__.
        
        --------------
        
        Installation
        ------------
        
        There are 4 methods of installation available (choose one):
        
        Through the ``conda`` package manager (`Anaconda Cloud <https://anaconda.org/conda-forge/bamnostic>`__)
        ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        .. code:: bash
        
            # first, add the conda-forge channel to your conda build
            conda config --add channels conda-forge
        
            # now bamnostic is available for install
            conda install bamnostic
        
        Through the Python Package Index (`PyPI <https://pypi.org/>`__)
        ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        .. code:: bash
        
            pip install bamnostic
        
            # or, if you don't have superuser access
            pip install --user bamnostic
        
        Through pip+Github
        ~~~~~~~~~~~~~~~~~~
        
        .. code:: bash
        
            # again, use --user if you don't have superuser access
            pip install -e git+https://github.com/betteridiot/bamnostic.git
        
            # or, if you don't have superuser access
            pip install --user -e git+https://github.com/betteridiot/bamnostic.git
        
        Traditional GitHub clone
        ~~~~~~~~~~~~~~~~~~~~~~~~
        
        .. code:: bash
        
            git clone https://github.com/betteridiot/bamnostic.git
            cd bamnostic
            pip install -e .
        
            # or, if you don't have superuser access
            pip install --user -e .
        
        --------------
        
        Quickstart
        ----------
        
        Bamnostic is meant to be a reduced drop-in replacement for
        `pysam <https://github.com/pysam-developers/pysam>`__. As such it has
        much the same API as ``pysam`` with regard to BAM-related operations.
        **Note**: the ``pileup()`` method is not supported at this time. ###
        Importing
        
        .. code:: python
        
            >>> import bamnostic as bs
        
        Loading your BAM file (Note: CRAM and CSI formats are not supported at this time)
        ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        Bamnostic comes with an example BAM (and respective BAI) file just to
        play around with the output. Note, however, that the example BAM file
        does not contain many reference contigs. Therefore, random access is
        limited. This example file is made availble through
        ``bamnostic.example_bam``, which is a just a string path to the BAM file
        within the package.
        
        .. code:: python
        
            >>> bam = bs.AlignmentFile(bs.example_bam, 'rb')
        
        Get the header
        ~~~~~~~~~~~~~~
        
        **Note**: this will print out the SAM header. If the SAM header is not
        in the BAM file, it will print out the dictionary representation of the
        BAM header. It is a dictionary of refID keys with contig names and
        length tuple values.
        
        .. code:: python
        
            >>> bam.header
            {0: ('chr1', 1575), 1: ('chr2', 1584)}
        
        Data validation through ``head()``
        ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        .. code:: python
        
            >>>bam.head(n=2)
            [EAS56_57:6:190:289:82  69  chr1    100 0   *   =   100 0   CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<; MF:C:192,
             EAS56_57:6:190:289:82  137 chr1    100 73  35M =   100 0   AGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCAC <<<<<<;<<<<<<<<<<;<<;<<<<;8<6;9;;2; MF:C:64 Aq:C:0  NM:C:0  UQ:C:0  H0:C:1  H1:C:0]
        
        Getting the first read
        ~~~~~~~~~~~~~~~~~~~~~~
        
        .. code:: python
        
            >>> first_read = next(bam)
            >>> print(first_read)
            EAS56_57:6:190:289:82   69  chr1    100 0   *   =   100 0   CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<; MF:C:192
        
        Exploring the read
        ~~~~~~~~~~~~~~~~~~
        
        .. code:: python
        
            # read name
            >>> print(first_read.read_name)
            EAS56_57:6:190:289:82
        
            # 0-based position
            >>> print(first_read.pos)
            99
        
            # nucleotide sequence
            >>> print(first_read.seq)
            CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA
        
            # Read FLAG
            >>> print(first_read.flag)
            69
        
            # decoded FLAG
            >>> bs.utils.flag_decode(first_read.flag)
            [(1, 'read paired'), (4, 'read unmapped'), (64, 'first in pair')]
        
        Random Access
        ~~~~~~~~~~~~~
        
        .. code:: python
        
            >>> for i, read in enumerate(bam.fetch('chr2', 1, 100)):
            ...    if i >= 3:
            ...        break
            ...    print(read)
        
            B7_591:8:4:841:340  73  chr2    1   99  36M *   0   0   TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAA    <<<<<<<<;<<<<<<<<;<<<<<;<;:<<<<<<<;;    MF:C:18 Aq:C:77 NM:C:0  UQ:C:0  H0:C:1  H1:C:0
            EAS54_67:4:142:943:582  73  chr2    1   99  35M *   0   0   TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA <<<<<<;<<<<<<:<<;<<<<;<<<;<<<:;<<<5 MF:C:18 Aq:C:41 NM:C:0  UQ:C:0  H0:C:1  H1:C:0
            EAS54_67:6:43:859:229   153 chr2    1   66  35M *   0   0   TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA +37<=<.;<<7.;77<5<<0<<<;<<<27<<<<<< MF:C:32 Aq:C:0  NM:C:0  UQ:C:0  H0:C:1  H1:C:0
        
        --------------
        
        Introduction
        ------------
        
        Next-Generation Sequencing
        ~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        The field of genomics requires sequencing data produced by
        Next-Generation sequencing (NGS) platforms (such as
        `Illumina <https://www.illumina.com/>`__). These data take the form of
        millions of short strings that represent the nucleotide sequences (A, T,
        C, or G) of the sample fragments processed by the NGS platform. More
        information regarding the NGS workflow can be found
        `here <https://www.illumina.com/content/dam/illumina-marketing/documents/products/illumina_sequencing_introduction.pdf>`__
        An example of a single entry (known as FASTQ) can be seen below (`FASTQ
        Format <https://en.wikipedia.org/wiki/FASTQ_format>`__):
        
        .. code:: bash
        
            @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
            GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
            +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
            IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
        
        Each entry details the read name, lenght, string representation, and
        quality of each aligned base along the read. ### SAM/BAM Format The data
        from the NGS platforms are often aligned to reference genome. That is,
        each entry goes through an alignment algorithm that finds the best
        position that the entry matches along a known reference sequence. The
        alignment step extends the original entry with a sundry of additional
        attributes. A few of the included attributes are contig, position, and
        Compact Idiosyncratic Gapped Alignment Report (CIGAR) string. The
        modified entry is called the An example Sequence Alignment Map (SAM)
        entry can be see below (`SAM
        format <https://samtools.github.io/hts-specs/SAMv1.pdf>`__):
        
        .. code:: bash
        
            @HD VN:1.5 SO:coordinate
            @SQ SN:ref LN:45
            r001   99 ref  7 30 8M2I4M1D3M = 37  39 TTAGATAAAGGATACTG *
            r002    0 ref  9 30 3S6M1P1I4M *  0   0 AAAAGATAAGGATA    *
            r003    0 ref  9 30 5S6M       *  0   0 GCCTAAGCTAA       * SA:Z:ref,29,-,6H5M,17,0;
            r004    0 ref 16 30 6M14N5M    *  0   0 ATAGCTTCAGC       *
            r003 2064 ref 29 17 6H5M       *  0   0 TAGGC             * SA:Z:ref,9,+,5S6M,30,1;
            r001  147 ref 37 30 9M         =  7 -39 CAGCGGCAT         * NM:i:1
        
        There are many benefits to the SAM format: human-readable, each entry is
        contained to a single line (supporting simple stream analysis), concise
        description of the read's quality and position, and a file header
        metadata that supports integrity and reproducibility. Additionally, a
        compressed form of the SAM format was designed in parallel. It is called
        the Binary Alignment Map
        (`BAM <https://samtools.github.io/hts-specs/SAMv1.pdf>`__). Using a
        series of clever byte encoding of each SAM entry, the data are
        compressed into specialized, concatenated GZIP blocks called Blocked GNU
        Zip Format (`BGZF <https://samtools.github.io/hts-specs/SAMv1.pdf>`__)
        blocks. Each BGZF block contains a finite amount of data (≈65Kb). While
        the whole file is GZIP compatible, each individual block is also
        independently GZIP compatible. This data structure, ultimately, makes
        the file larger than just a normal GZIP file, but it also allow for
        random access within the file though the use of a BAM Index file
        (`BAI <https://samtools.github.io/hts-specs/SAMv1.pdf>`__).
        
        BAI
        ~~~
        
        The BAI file, often produced via
        `samtools <http://samtools.sourceforge.net/>`__, requires the BAM file
        to be sorted prior to indexing. Using a modified R-tree binning
        strategy, each reference contig is divided into sequential,
        non-overlapping bins. That is a parent bin may contain numerous
        children, but none of the children bins overlap another's assigned
        interval. Each BAM entry is then assigned to the bin that fully contains
        it. A visual description of the binning strategy can be found
        `here <https://samtools.github.io/hts-specs/SAMv1.pdf>`__. Each bin is
        comprised of chunks, and each chunk contains its respective start and
        stop byte positions within the BAM file. In addition to the bin index, a
        linear index is produced as well. Again, the reference contig is divided
        into equally sized windows (covering ≈16Kbp/each). Along those windows,
        the start offset of the first read that ***overlaps*** that window is
        stored. Now, given a region of interest, the first bin that overlaps the
        region is looked up. The chunks in the bin are stored as *virtual
        offsets*. A virtual offset is a 64-bit unsigned integer that is
        comprised of the compressed offset ``coffset`` (indicating the byte
        position of the start of the containing BGZF block) and the uncompressed
        offset ``uoffset`` (indicating the byte position within the uncompressed
        data of the BGZF block that the data starts). A virtual offset is
        calculated by:
        
        .. code:: python
        
            virtual_offset = coffset << 16 | uoffset
        
        Similarly, the complement of the above is as follows:
        
        .. code:: python
        
            coffset = virtual_offset >> 16
            uoffset = virtual_offset ^ (coffset << 16)
        
        A simple seek call against the BAM file will put the head at the start
        of your region of interest.
        
        --------------
        
        Motivation
        ----------
        
        The common practice within the field of genomics/genetics when analyzing
        BAM files is to use the program known as
        `samtools <http://samtools.sourceforge.net/>`__. The maintainers of
        samtools have done a tremendous job of providing distributions that work
        on a multitude of operating systems. While samtools is powerful, as a
        command line interface, it is also limited in that it doesn't really
        afford the ability to perform real-time dynamic processing of reads
        (without requiring many system calls to samtools). Due to its general
        nature and inherent readability, a package was written in Python called
        `pysam <https://github.com/pysam-developers/pysam>`__. This package
        allowed users a very comfortable means to doing such dynamic processing.
        However, the foundation of these tools is built on a C-API called
        `htslib <https://github.com/samtools/htslib>`__ and htslib cannot be
        compiled in a Windows environment. By extension, neither can pysam. In
        building a tool for genomic visualization, I wanted it to be platform
        agnostic. This is precisely when I found out that the tools I had
        planned to use as a backend did not work on Windows...the most prevalent
        operation system in the end-user world. So, I wrote **bamnostic**. As of
        this writing, bamnostic is OS-agnostic and written completely in Pure
        Python--requiring only the standard library (and ``pytest`` for the test
        suite). Special care was taken to ensure that it would run on all
        versions of CPython 2.7 or greater. Additionally, it runs in both stable
        versions of PyPy. While it may perform slower than its C counterparts,
        bamnostic opens up the science to a much greater end-user group. Lastly,
        it is lightweight enough to fit into any simple web server (e.g.
        `Flask <http://flask.pocoo.org/>`__), further expanding the science of
        genetics/genomics.
        
        --------------
        
        Citation
        --------
        
        If you use bamnostic in your analyses, please consider citing `Li et al
        (2009) <http://www.ncbi.nlm.nih.gov/pubmed/19505943>`__ as well.
        Regarding the citation for bamnostic, please use the JoSS journal
        article (click on the JOSS badge above) or use the following: >Sherman
        MD and Mills RE, (2018). BAMnostic: an OS-agnostic toolkit for genomic
        sequence analysis . Journal of Open Source Software, 3(28), 826,
        https://doi.org/10.21105/joss.00826
        
        --------------
        
        Community Guidelines:
        ---------------------
        
        Eagerly accepting PRs for improvements, optimizations, or features. For
        any questions or issues, please feel free to make a post to bamnostic's
        `Issue tracker <https://github.com/betteridiot/bamnostic/issues>`__ on
        github or read over our
        `CONTRIBUTING <https://github.com/betteridiot/bamnostic/blob/master/CONTRIBUTING.md>`__
        documentation.
        
        .. |Build Status| image:: https://travis-ci.org/betteridiot/bamnostic.svg?branch=master
           :target: https://travis-ci.org/betteridiot/bamnostic
        .. |noarch| image:: https://img.shields.io/circleci/project/github/conda-forge/bamnostic-feedstock/master.svg?label=noarch
           :target: https://circleci.com/gh/conda-forge/bamnostic-feedstock
        .. |Documentation Status| image:: https://readthedocs.org/projects/bamnostic/badge/?version=latest
           :target: https://bamnostic.readthedocs.io/en/latest/?badge=latest
        .. |Conda Version| image:: https://img.shields.io/conda/vn/conda-forge/bamnostic.svg
           :target: https://anaconda.org/conda-forge/bamnostic
        .. |PyPI version| image:: https://badge.fury.io/py/bamnostic.svg
           :target: https://badge.fury.io/py/bamnostic
        .. |Maintainability| image:: https://api.codeclimate.com/v1/badges/d7e36e72f109c598c86d/maintainability
           :target: https://codeclimate.com/github/betteridiot/bamnostic/maintainability
        .. |status| image:: http://joss.theoj.org/papers/9952b35bbb30ca6c01e6a27b80006bd8/status.svg
           :target: http://joss.theoj.org/papers/9952b35bbb30ca6c01e6a27b80006bd8
        .. |DOI| image:: https://zenodo.org/badge/DOI/10.5281/zenodo.1341959.svg
           :target: https://doi.org/10.5281/zenodo.1341959
        .. |License| image:: https://img.shields.io/badge/License-BSD%203--Clause-blue.svg
           :target: https://github.com/betteridiot/bamnostic/blob/master/LICENSE
        .. |Downloads| image:: http://pepy.tech/badge/bamnostic
           :target: http://pepy.tech/project/bamnostic
        .. |Conda Downloads| image:: https://img.shields.io/conda/dn/conda-forge/bamnostic.svg
           :target: https://anaconda.org/conda-forge/bamnostic
        
Keywords: BAM pysam genomics genetics struct
Platform: UNKNOWN
Classifier: Development Status :: 4 - Beta
Classifier: Intended Audience :: Developers
Classifier: Intended Audience :: End Users/Desktop
Classifier: Intended Audience :: Science/Research
Classifier: Intended Audience :: Information Technology
Classifier: License :: OSI Approved :: BSD License
Classifier: Natural Language :: English
Classifier: Operating System :: Unix
Classifier: Operating System :: Microsoft :: Windows
Classifier: Operating System :: MacOS
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.0
Classifier: Programming Language :: Python :: 3.1
Classifier: Programming Language :: Python :: 3.2
Classifier: Programming Language :: Python :: 3.3
Classifier: Programming Language :: Python :: 3.4
Classifier: Programming Language :: Python :: 3.5
Classifier: Programming Language :: Python :: 3.6
Classifier: Programming Language :: Python :: 3.7
Classifier: Programming Language :: Python :: Implementation :: CPython
Classifier: Programming Language :: Python :: Implementation :: PyPy
Classifier: Topic :: Scientific/Engineering
Classifier: Topic :: Scientific/Engineering :: Information Analysis
