Metadata-Version: 2.1
Name: SemiBin
Version: 0.6.0
Summary: Metagenomic binning with semi-supervised siamese neural network
Home-page: https://github.com/BigDataBiology/SemiBin
Author: Shaojun Pan
Author-email: shaojun1997777@gmail.com
License: MIT
Description: # SemiBin: Semi-supervised Metagenomic Binning Using Siamese Neural Networks
        
        Command tool for metagenomic binning with semi-supervised deep learning using
        information from reference genomes.
        
        [![Test Status](https://github.com/BigDataBiology/SemiBin/actions/workflows/semibin_test.yml/badge.svg)](https://github.com/BigDataBiology/SemiBin/actions/workflows/semibin_test.yml)
        [![Documentation Status](https://readthedocs.org/projects/semibin/badge/?version=latest)](https://semibin.readthedocs.io/en/latest/?badge=latest)
        [![License: MIT](https://img.shields.io/badge/License-MIT-blue.svg)](https://opensource.org/licenses/MIT)
        
        _NOTE_: This tool is still in development. You are welcome to try it out and
        feedback is appreciated, but expect some bugs/rapid changes until it
        stabilizes. Please use [Github
        issues](https://github.com/BigDataBiology/SemiBin/issues) for bug reports and
        the [SemiBin users mailing-list](https://groups.google.com/g/semibin-users) for
        more open-ended discussions or questions.
        
        If you use this software in a publication please cite:
        
        > SemiBin: Incorporating information from reference genomes with
        > semi-supervised deep learning leads to better metagenomic assembled genomes
        > (MAGs)
        > Shaojun Pan, Chengkai Zhu, Xing-Ming Zhao, Luis Pedro Coelho
        > bioRxiv 2021.08.16.456517; doi:
        > [https://doi.org/10.1101/2021.08.16.456517](https://doi.org/10.1101/2021.08.16.456517)
        
        
        ## Installation
        
        SemiBin runs on Python 3.7-3.9.
        
        ### Bioconda ### 
        
        _NOTE_: If you want to use SemiBin with GPU, you need to install Pytorch with GPU support. Or `conda install -c bioconda semibin` just install Pytorch with CPU support.
        
        ```bash
        conda create -n SemiBin python==3.7
        conda activate SemiBin
        conda install -c conda-forge -c bioconda semibin
        conda install pytorch torchvision torchaudio cudatoolkit=10.2 -c pytorch-lts
        ```
        
        ### Source
        
        You can download the source code from github and install.
        
        Install dependence packages using conda:
        [MMseqs2](https://github.com/soedinglab/MMseqs2),
        [Bedtools](http://bedtools.readthedocs.org/]), [Hmmer](http://hmmer.org/), and
        [Fraggenescan](https://sourceforge.net/projects/fraggenescan/).
        
        ```bash
        conda install -c conda-forge -c bioconda mmseqs2=13.45111
        conda install -c bioconda bedtools hmmer fraggenescan==1.30
        ```
        
        Once the dependencies are installed, you can install by running:
        
        ```bash
        python setup.py install
        ```
        
        ## Examples of binning
        
        _NOTE_: The `SemiBin` API is a work-in-progress. The examples refer to
        version `0.5`, but this may change in the near future (after the release of
        version 1.0, we expect to freeze the API for [at least 5
        years](https://big-data-biology.org/software/commitments/)). We are very happy
        to [hear any feedback on API
        design](https://groups.google.com/g/semibin-users), though.
        
        SemiBin runs on single-sample, co-assembly and multi-sample binning. 
        
        The basic idea of using SemiBin with single-sample and co-assembly is:
        
        (1) generating _data.csv_ and _data_split.csv_ (used in training) for every sample,
        
        (2) training the model for every sample, and
        
        (3) binning the contigs for every contig with the model trained from the same sample.
        
        When using multi-sample binning, the basic idea is very similar, the inputs are the contigs combined from several samples and bam files from several samples. And then we also generate _data.csv_ and _data_split.csv_ and do training and binning for every  sample. The only difference compared to single-sample binning is the _data.csv_ and _data_split.csv_ have the abundance information from several samples.
        
        Considering the issue that contig annotations and model training requires significant computational time and the algorithm design of SemiBin, we proposed SemiBin(pretrain) for _single-sample binning_ to: 
        
        (1) train a model from one sample or several samples (or used our built-in pretrained model) and
        
        (2) directly apply this model to other samples.
        
        For the details and examples of every command to run SemiBin with these binning modes,  please [read the docs](https://semibin.readthedocs.io/en/latest/usage/).
        
        ## Easy single/co-assembly binning mode
        
        You will need the following inputs:
        
        1. A contig file (`contig.fna` in the example below)
        2. BAM files from mapping short reads to the contigs
        
        The `single_easy_bin` command can be used in single-sample and co-assembly
        binning modes (contig annotations using mmseqs with GTDB reference genome) to
        get results in a single step.
        
        ```bash
        SemiBin single_easy_bin -i contig.fna -b *.bam -o output
        ```
        
        In this example, SemiBin will download GTDB to
        `$HOME/.cache/SemiBin/mmseqs2-GTDB/GTDB`. You can change this default using the
        `-r` argument.
        
        You can use `--environment` with `human_gut`, `dog_gut`, `ocean`, `soil`,
        `cat_gut`, `human_oral`, `mouse_gut`, `pig_gut`, `built_environment`,
        `wastewater`, or `global` to use one of our built-in models.
        
        ```bash
        SemiBin single_easy_bin -i contig_S1.fna -b S1.bam -o output --environment human_gut
        ```
        
        ## Easy multi-samples binning mode
        
        The `multi_easy_bin` command can be used in multi-samples binning modes (contig
        annotations using mmseqs with GTDB reference genome).
        
        
        You will need the following inputs:
        
        1. a combined contig file
        
        2. BAM files from mapping
        
        For every contig, format of the name is `<sample_name>:<contig_name>`, where
        `:` is the default separator (it can be changed with the `--separator`
        argument). _NOTE_: Make sure the sample names are unique and  the separator
        does not introduce confusion when splitting. For example:
        
        ```bash
        >S1:Contig_1
        AGATAATAAAGATAATAATA
        >S1:Contig_2
        CGAATTTATCTCAAGAACAAGAAAA
        >S1:Contig_3
        AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA
        >S2:Contig_1
        AATGATATAATACTTAATA
        >S2:Contig_2
        AAAATATTAAAGAAATAATGAAAGAAA
        >S3:Contig_1
        ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG
        >S3:Contig_2
        AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT
        >S3:Contig_3
        CAAATACGAATGATTCTTTATTAGATTATCTTAATAAGAATATC
        ```
        
        You can get the results with one line of code. 
        
        ```bash
        SemiBin multi_easy_bin -i contig_whole.fna -b *.bam -o output 
        ```
        
        ## Output
        
        The output folder will contain:
        
        1. Datasets used for training and clustering.
        
        2. Saved semi-supervised deep learning model.
        
        3. Output bins.
        
        4. Some intermediate files.
        
        For every sample, reconstructed bins are in `output_bins` directory. Using
        reclustering, reconstructed bins are in `output_recluster_bins` directory.
        
        For more details about the output, [read the
        docs](https://semibin.readthedocs.io/en/latest/output/).
        
        ## Advanced workflows
        
        You can run individual steps by yourself, which can enable using compute
        clusters to make the binning process faster (especially in multi-samples
        binning mode). For example, `single_easy_bin` includes the following steps:
        `generate_cannot_links`,`generate_data_single` and `bin`; while `multi_easy_bin`
        includes the following steps: `generate_cannot_links`, `generate_data_multi` and `bin`.
        
        In advanced mode, you can also use our built-in pre-trained model in
        single-sample binning mode. Here we provide pre-trained models for human gut,
        dog gut, marine, soil, cat gut, human oral, mouse gut, pig gut,
        built_environment, wastewater and global (train from all environments listed)
        environment.
        
        A very easy way to run SemiBin with a built-in model
        (`human_gut`/`dog_gut`/`ocean`/`soil`/`cat_gut`/`human_oral`/`mouse_gut`/`pig_gut`/`built_environment`/`wastewater`/`global` for single-sample binning):
        
        ```bash
        SemiBin single_easy_bin -i contig_S1.fna -b S1.bam -o output --environment human_gut
        ```
        
        Another suggestion is that you can pre-train a model from part of your dataset,
        which can provide a balance as it is faster than training for each sample while
        achieving better results than a pre-trained model from another dataset.
        
        (1) Generate `data.csv/data_split.csv` for every sample
        
        Single-sample/co-assembly binning:
        
        ```bash
        SemiBin generate_data_single -i contig_S1.fna -b S1.bam -o output
        ```
        
        Multi-sample binning:
        
        ```bash
        SemiBin generate_data_multi -i contig_combined.fna -b S1.bam S2.bam S3.bam S4.bam S5.bam -o output -s :
        ```
        
        (2) Generate cannot-link for every sample
        
        ```bash
        SemiBin generate_cannot_links -i contig_S1.fna -o output
        ```
        
        (3) Train a pre-trained model across several samples (For single-sample binning, make sure the input files are corresponding.)
        
        ```bash
        SemiBin train -i S1.fna S2.fna S3.fna --data S1/train.csv S2/train.csv S3/train.csv --data-split S1/train_split.csv S2/train_split.csv S3/train_split.csv -c S1/cannot.txt s2/cannot.txt S3/cannot.txt -o output --mode several 
        ```
        Or just train a model from one sample. If you are using multi-sample binning, here the contig is the contig for every sample.
        
        Single-sample/co-assembly binning:
        
        ```bash
        SemiBin train -i contig.fna --data train.csv --data-split train_split.csv -c cannot.txt -o output --mode single
        ```
        
        Multi-sample binning(similar for other samples) :
        
        ```bash
        SemiBin train -i contig_S1.fna --data S1/train.csv --data-split S1/train_split.csv -c S1/cannot.txt -o output --mode single
        ```
        
        (4) Bin with the trained model.  If you are using multi-sample binning, here the contig is the contig for every sample and the bam files are still from several samples.
        
        Single-sample/co-assembly binning:
        
        ```bash
        SemiBin bin -i contig.fna --model model.h5 --data data.csv -o output
        ```
        
        Multi-sample binning(similar for other samples):
        
        ```bash
        SemiBin bin -i contig_S1.fna --model model.h5 --data S1/data.csv -o output
        ```
        
        Or our built-in model (human_gut, dog_gut or ocean) (just for single-sample binning)
        
        ```bash
        SemiBin bin -i contig.fna --data data.csv -o output --environment human_gut
        ```
        
        For more details on usage, including every command on how to run SemiBin with different binning modes, please [read the docs](https://semibin.readthedocs.io/en/latest/usage/).
        
        
Platform: UNKNOWN
Classifier: Development Status :: 4 - Beta
Classifier: Intended Audience :: Science/Research
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Topic :: Scientific/Engineering :: Artificial Intelligence
Classifier: License :: OSI Approved :: MIT License
Classifier: Programming Language :: Python :: 3.7
Classifier: Programming Language :: Python :: 3.8
Classifier: Programming Language :: Python :: 3.9
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Description-Content-Type: text/markdown
