Metadata-Version: 2.1
Name: S3N2Bin
Version: 0.1.1
Summary: Metagenomic binning with semi-supervised siamese neural network
Home-page: https://github.com/BigDataBiology/S3N2Bin
Author: Shaojun Pan
Author-email: shaojun1997777@gmail.com
License: MIT
Description: # S³N²Bin (Semi-supervised Siamese Neural Network for metagenomic binning)
        
        [![Test Status](https://github.com/BigDataBiology/S3N2Bin/actions/workflows/s3n2bin_test.yml/badge.svg)](https://github.com/BigDataBiology/S3N2Bin/actions/workflows/s3n2bin_test.yml)
        [![Documentation Status](https://readthedocs.org/projects/s3n2bin/badge/?version=latest)](https://s3n2bin.readthedocs.io/en/latest/?badge=latest)
        [![License: MIT](https://img.shields.io/badge/License-MIT-blue.svg)](https://opensource.org/licenses/MIT)
        
        _NOTE_: This tool is still in development. You are welcome to try it out and
        feedback is appreciated, but expect some bugs/rapid changes until it
        stabilizes. Please use [Github
        issues](https://github.com/BigDataBiology/S3N2Bin/issues) for bug reports and
        the [Discussions](https://github.com/BigDataBiology/S3N2Bin/discussions) for
        more open-ended discussions/questions.
        
        Command tool for metagenomic binning with semi-supervised deep learning using
        information from reference genomes.
        
        ## Install
        
        S<sup>3</sup>N<sup>2</sup>Bin runs on Python 3.6-3.8.
        
        ### Install from source
        
        You can download the source code from github and install.
        
        Install dependence packages using conda: [Bedtools](http://bedtools.readthedocs.org/]), [Hmmer](http://hmmer.org/),  [Fraggenescan](https://sourceforge.net/projects/fraggenescan/) and [cmake](https://cmake.org/).
        
        ```bash
        conda install -c bioconda bedtools hmmer fraggenescan
        ```
        ```bash
        conda install -c anaconda cmake=3.19.6
        ```
        
        ```bash
        python setup.py install
        ```
        
        ## Examples
        
        ## Easy single/co-assembly binning mode
        
        You will need the following inputs:
        
        1. A contig file (`contig.fna` in the example below)
        2. BAM files from mapping
        
        You can get the results with one line of code. The `single_easy_bin` command can be used in
        single-sample and co-assembly binning modes (contig annotations using mmseqs
        with GTDB reference genome). `single_easy_bin` includes the following steps:
        `predict_taxonomy`,`generate_data_single` and `bin`.
        
        ```bash
        S3N2Bin single_easy_bin -i contig.fna -b *.bam -o output
        ```
        
        In this example, S³N²Bin will download GTDB to
        `$HOME/.cache/S3N2Bin/mmseqs2-GTDB/GTDB`. You can change this default using the
        `-r` argument.
        
        ## Easy multi-samples binning mode
        
        The `multi_easy_bin` command can be used in
        multi-samples binning modes (contig annotations using mmseqs
        with GTDB reference genome). `multi_easy_bin` includes following step:
        `predict_taxonomy`, `generate_data_multi` and `bin`.
        
        You will need the following inputs.
        
        1. A combined contig file
        
        2. BAM files from mapping
        
        For every contig, format of the name is `<sample_name>:<contig_name>`, where
        `:` is the default separator (it can be changed with the `--separator`
        argument). *Note:* Make sure the sample names are unique and  the separator
        does not introduce confusion when splitting. For example:
        
        ```bash
        >S1:Contig_1
        AGATAATAAAGATAATAATA
        >S1:Contig_2
        CGAATTTATCTCAAGAACAAGAAAA
        >S1:Contig_3
        AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA
        >S2:Contig_1
        AATGATATAATACTTAATA
        >S2:Contig_2
        AAAATATTAAAGAAATAATGAAAGAAA
        >S3:Contig_1
        ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG
        >S3:Contig_2
        AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT
        >S3:Contig_3
        CAAATACGAATGATTCTTTATTAGATTATCTTAATAAGAATATC
        ```
        
        You can get the results with one line of code.
        
        ```bash
        S3N2Bin multi_easy_bin -i contig_whole.fna -b *.bam -o output
        ```
        
        ## Advanced-bin mode
        
        You can run individual steps by yourself, which can enable using compute
        clusters to make the binning process faster (especially in multi-samples
        binning mode).
        
        For more details on usage, including information on how to run individual steps
        separately, [read the docs](https://s3n2bin.readthedocs.io/en/latest/usage/).
        
        ## Output
        
        The output folder will contain
        
        1. Datasets used for training and clustering.
        
        2. Saved semi-supervised deep learning model.
        
        3. Output bins.
        
        4. Some intermediate files.
        
        For every sample, reconstructed bins are in `output_recluster_bins` directory.
        
        For more details about the output, [read the docs](https://s3n2bin.readthedocs.io/en/latest/output/).
        
        
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Science/Research
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Topic :: Scientific/Engineering :: Artificial Intelligence
Classifier: License :: OSI Approved :: MIT License
Classifier: Programming Language :: Python :: 3.6
Classifier: Programming Language :: Python :: 3.7
Classifier: Programming Language :: Python :: 3.8
Description-Content-Type: text/markdown
